Home

Download

Statistics

Examples

Help

Contact

	Gene Summary
	Translation studies in PubMed
	Exon Skipping Events
	Expression
	Expression Regulation
	Associated Genes
	Protein 3D Structure
	Protein-Protein Interaction
	Mutations
	Prognostic Analysis
	Gender Association
	Age Association
	Related Drugs
	Related Diseases

Translation Factor: NSUN3 (NCBI Gene ID:63899)

Gene Summary

Gene Summary

Gene Information	Gene Name: NSUN3
	Gene ID: 63899
	Gene Symbol	NSUN3
	Gene ID	63899
	Gene Name	NOP2/Sun RNA methyltransferase 3
	Synonyms	MST077\|MSTP077
	Cytomap	3q11.2
	Type of Gene	protein-coding
	Description	tRNA (cytosine(34)-C(5))-methyltransferase, mitochondrialNOL1/NOP2/Sun domain family member 3NOP2/Sun RNA methyltransferase family member 3putative methyltransferase NSUN3
	Modification date	20200313
	UniProtAcc	Q9H649

Child GO biological process term(s) under GO:0006412

GO ID	GO term
GO:0006417	Regulation of translation
GO:0032543	Mitochondrial translation
GO:0005840	Ribosome
GO:0006412	Translation

Gene ontology of translaction factor with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Hgene	NSUN3	GO:0002127	tRNA wobble base cytosine methylation	27214402\|27356879\|27497299

Inferred gene age of translation factor.

Gene	Inferred gene age group among (0 - 67.6], (67.6 - 355.7], (355.7 - 733], (733 - 1119.25], >1119.25
NSUN3	(355.7 - 733]

Top

Translation Studies in PubMed

We searched PubMed using 'NSUN3[title] AND translation [title] AND human.'

Gene	Title	PMID
NSUN3	NSUN3 and ABH1 modify the wobble position of mt-tRNAMet to expand codon recognition in mitochondrial translation	27497299

Top

Exon Skipping Events

Skipped exons in TCGA and GTEx based on Ensembl gene isoform structure.
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.
For more annotations, please visit our ExonSkipDB.

Open reading frame (ORF) analsis of exon skipping events based on Ensembl gene isoform structure.
* Click on the break point to see the gene structure around the break point region using the UCSC Genome Browser.

ENST	Exon skip start (DNA)	Exon Skip end (DNA)	ORF
ENST00000314622	93812983	93813138	Frame-shift

Exon skipping position in the amino acid sequence.

ENST

Exon skip start (DNA)

Exon Skip end (DNA)

Len(transcript seq)

Exon skip start (mRNA)

Exon Skip end (mRNA)

Len(amino acid seq)

Exon skip start (AA)

Exon Skip end (AA)

Potentially (partially) lost protein functional features of UniProt.

UniProtAcc

Exon skip start (AA)

Exon Skip end (AA)

Function feature start (AA)

Function feature end (AA)

Functional feature type

Functional feature desc.

Top

Expression

Gene expression level across TCGA pancancer

Gene expression level across GTEx pantissue

Expression level of gene isoforms across TCGA pancancer

Expression level of gene isoforms across GTEx pantissue

Cancer(tissue) type-specific expression level of Translation factor using z-score distriution

Differential expression between tumor and matched normal (in the cancer types with more than 10 matched samples)

Cancer type	Translation factor	FC	adj.pval
HNSC	NSUN3	-1.20648775901954	0.0232541393677366

Top

Expression Regulation

Translation factor expression regulation through miRNA binding

Cancer type	Gene	miRNA	TargetScan binding score (Context++ score percentile)	Coefficient	Pvalue
CESC	NSUN3	hsa-miR-330-3p	83	0.319996459236965	0.00445411540868611

Translation factor expression regulation through methylation in the promoter of Translation factor

Cancer type

Gene

methyl group b

methyl group a

DEG pval

avg methyl in b

avg methyl in a

avg exp in b

avg exp in a

Translation factor expression regulation through methylation in the gene body of Translation factor (positive regulation)

Cancer type

Gene

methyl group b

methyl group a

DEG pval

avg methyl in b

avg methyl in a

avg exp in b

avg exp in a

Translation factor expression regulation through copy number variation of Translation factor

Cancer type	Gene	Coefficient	Pvalue
DLBC	NSUN3	0.109864956	0.000246462
LAML	NSUN3	0.038878445	0.030574589

Top

Associated Genes

Strongly correlated genes belong to cellular important gene groups with NSUN3 (coefficient>0.8, pval<0.05, node color based on FC between tumor and matched normal). Significantly associated important genes in the individual cancer types. * Cell metabolism gene: cell metabolism genes from REACTOME (black edge), IUPHAR: drug target genes from IUPHAR (blue edge), Kinase: human kinase genes (brown edge), CGC: cancer gene census genes (orange edge), TSG: tumor suppresor genes (purple edge), Epifactor: epigenetic factors (light blue edge), TF: transcription factors (green)

Cancer type	Gene group	Translation factor	Correlated gene	Coefficient	Pvalue
KICH	IUPHAR	NSUN3	SLC35A5	0.814234096	9.86E-23
THYM	Cell metabolism gene	NSUN3	ARFGEF2	0.806427389	3.74E-29
THYM	Cell metabolism gene	NSUN3	PRKAA1	0.814764422	3.48E-30
THYM	Cell metabolism gene	NSUN3	PIKFYVE	0.834805919	6.81E-33
THYM	CGC	NSUN3	ERCC4	0.800877252	1.71E-28
THYM	CGC	NSUN3	ATR	0.819697536	8.06E-31
THYM	Epifactor	NSUN3	SMARCAD1	0.802107384	1.22E-28
THYM	Epifactor	NSUN3	SMEK2	0.810416146	1.22E-29
THYM	Epifactor	NSUN3	PRKAA1	0.814764422	3.48E-30
THYM	Epifactor	NSUN3	ATR	0.819697536	8.06E-31
THYM	Epifactor	NSUN3	ARID4B	0.843801152	3.14E-34
THYM	IUPHAR	NSUN3	PRKAA1	0.814764422	3.48E-30
THYM	IUPHAR	NSUN3	ATR	0.819697536	8.06E-31
THYM	IUPHAR	NSUN3	PIKFYVE	0.834805919	6.81E-33
THYM	Kinase	NSUN3	PRKAA1	0.814764422	3.48E-30
THYM	Kinase	NSUN3	ATR	0.819697536	8.06E-31
THYM	TF	NSUN3	ZBTB11	0.850478228	2.82E-35
THYM	TSG	NSUN3	PRKAA1	0.814764422	3.48E-30
THYM	TSG	NSUN3	ATR	0.819697536	8.06E-31
UCS	Cell metabolism gene	NSUN3	ARFGEF2	0.806427389	3.74E-29
UCS	Cell metabolism gene	NSUN3	PRKAA1	0.814764422	3.48E-30
UCS	Cell metabolism gene	NSUN3	PIKFYVE	0.834805919	6.81E-33
UCS	CGC	NSUN3	ERCC4	0.800877252	1.71E-28
UCS	CGC	NSUN3	ATR	0.819697536	8.06E-31
UCS	Epifactor	NSUN3	SMARCAD1	0.802107384	1.22E-28
UCS	Epifactor	NSUN3	SMEK2	0.810416146	1.22E-29
UCS	Epifactor	NSUN3	PRKAA1	0.814764422	3.48E-30
UCS	Epifactor	NSUN3	ATR	0.819697536	8.06E-31
UCS	Epifactor	NSUN3	ARID4B	0.843801152	3.14E-34
UCS	IUPHAR	NSUN3	PRKAA1	0.814764422	3.48E-30
UCS	IUPHAR	NSUN3	ATR	0.819697536	8.06E-31
UCS	IUPHAR	NSUN3	PIKFYVE	0.834805919	6.81E-33
UCS	Kinase	NSUN3	PRKAA1	0.814764422	3.48E-30
UCS	Kinase	NSUN3	ATR	0.819697536	8.06E-31
UCS	TF	NSUN3	ZBTB11	0.850478228	2.82E-35
UCS	TSG	NSUN3	PRKAA1	0.814764422	3.48E-30
UCS	TSG	NSUN3	ATR	0.819697536	8.06E-31
UVM	CGC	NSUN3	ATR	0.817814786	2.10E-20
UVM	Epifactor	NSUN3	HLTF	0.803252347	3.13E-19
UVM	Epifactor	NSUN3	ATR	0.817814786	2.10E-20
UVM	IUPHAR	NSUN3	ATP11B	0.804703843	2.41E-19
UVM	IUPHAR	NSUN3	ATR	0.817814786	2.10E-20
UVM	Kinase	NSUN3	ATR	0.817814786	2.10E-20
UVM	TF	NSUN3	ZBTB11	0.803305879	3.10E-19
UVM	TF	NSUN3	ZNF148	0.806021119	1.90E-19
UVM	TF	NSUN3	ZNF654	0.812387844	5.90E-20
UVM	TF	NSUN3	CGGBP1	0.830348915	1.68E-21
UVM	TSG	NSUN3	HLTF	0.803252347	3.13E-19
UVM	TSG	NSUN3	ATR	0.817814786	2.10E-20

Top

Protein structure

Protein 3D structure
Visit iCn3D.

Top

Protein-Protein Interaction

Protein-protein interaction networks
* Overlap between up-regulated DEGs (log2FC<-1 and adj.P<0.05) and STRING PPI network (center: Translation factor, node: DEGs, edges: weighted by -log2(adj.P))

Overlap between down-regulated DEGs (log2FC>1 and adj.P<0.05) and STRING PPI network (center: Translation factor, node: DEGs, edges: weighted by -log2(adj.P))

* Edge colors based on TCGA cancer types.

* Overlap between DEGs (log2FC>1 and adj.P<0.05) and STRING PPI network per cancer (center: Translation factor, node: DEGs, node color: log2FC, edges: weighted by -log2(adj.P))

Cancer type	Translation factor	Interacting protein coding gene	FC	adj.pval
PRAD	NSUN3	METTL1	-1.63380159139027	0.0001086303301899
BRCA	NSUN3	FTSJ3	-3.46913955088154	0.000242834408791295
PRAD	NSUN3	NSUN5	-1.07206800773388	0.000350945007587088
THCA	NSUN3	NSUN5	-1.78607330603427	0.000361893082651998
KICH	NSUN3	WDR12	1.27437010311891	0.000631332397460937
ESCA	NSUN3	METTL1	-1.44609135299267	0.0009765625
ESCA	NSUN3	WDR12	-4.50085604434153	0.001953125
ESCA	NSUN3	NSUN5	-6.13489313057259	0.0029296875
ESCA	NSUN3	DDX55	-5.35907926138822	0.009765625
LIHC	NSUN3	METTL1	-1.50812991098563	0.0171088642188067
KIRC	NSUN3	METTL1	-3.13288625863516	0.0180140696589296
CHOL	NSUN3	TRMT11	-1.83882690193514	0.01953125
BRCA	NSUN3	MTO1	-1.09257288004134	0.0200878768110553
BLCA	NSUN3	GTPBP4	1.58690285996278	0.0289306640625
PRAD	NSUN3	TRMT11	1.06087533610535	0.0291755363147523
READ	NSUN3	FTSJ3	-3.56153245977502	0.03125
ESCA	NSUN3	FTSJ3	-2.37306570439978	0.0419921875
BRCA	NSUN3	METTL1	-4.52332520302616	1.31899889155303e-16
STAD	NSUN3	METTL1	-2.17210826407194	1.42958015203476e-07
LUAD	NSUN3	PUS1	-2.33149816249926	1.55042044095848e-09
KICH	NSUN3	PUS1	-1.07830972491459	1.82986259460449e-05
STAD	NSUN3	DDX55	-1.85990041226941	2.00420618057251e-06
STAD	NSUN3	FTSJ3	-1.61954756070611	2.00420618057251e-06
PRAD	NSUN3	DDX55	-1.06119608116825	2.24248086489894e-05
LIHC	NSUN3	GTPBP4	-1.61937717479796	2.46746298874691e-06
KIRC	NSUN3	MTO1	-1.03081816734249	2.47012955490964e-07
KIRP	NSUN3	MTO1	-3.77202252731403	2.49594449996948e-07
LIHC	NSUN3	WDR12	-3.16467679630325	2.54824448841554e-08
HNSC	NSUN3	DDX55	-1.92269002566393	2.61776540355641e-06
LUAD	NSUN3	DDX55	-2.69446926676317	2.61881883428183e-09
KIRP	NSUN3	DDX55	-1.24324098541014	2.66358256340027e-06
KICH	NSUN3	FTSJ3	1.78589325244141	2.98023223876953e-07
KIRC	NSUN3	NSUN7	-2.83700247829284	3.11293121252179e-12
LUSC	NSUN3	NSUN5	-4.54569982003047	3.6518313538953e-08
BRCA	NSUN3	NSUN5	-1.29239909533653	3.65366474535211e-14
KIRC	NSUN3	DDX55	-1.14218277964996	4.4523606197609e-12
PRAD	NSUN3	MTO1	-2.87181302059323	4.59461327401057e-05
LUSC	NSUN3	NSUN7	-3.00542519641248	5.24011361196257e-05
HNSC	NSUN3	GTPBP4	2.02268965512305	6.75183794101032e-05
STAD	NSUN3	WDR12	-2.46721337744962	6.79492950439454e-06
KICH	NSUN3	DDX55	-1.36704804776623	7.49826431274414e-05
KIRP	NSUN3	PUS1	-4.4419119304275	8.84756445884705e-09

Protein-protein interactors with this translation factor (BIOGRID-3.4.160)

PPI interactors with NSUN3

LRRTM1, LRFN4, THUMPD3, CD79A, TOR1AIP2, SLC2A12, HEXIM1, PHB2, HSPD1, PIPSL, KLRC2, VSIG4, CBWD2, UQCRFS1, FTL, KLK1, SLC31A1, TACSTD2, RNF181, CTLA4, KLRD1, RAMP2, BSCL2, CD3D, MAGEA8, GRPR, TMEM106A, MPL, OSTM1, P2RY10, GPR182, ADAMTS4,

Top

Mutations

Clinically associated variants from ClinVar.

Gene	Chr	Position	RefSeq	VarSeq	RefSeeq	VarType	Pathogenic	Disease	VarInfo
NSUN3	chr3	93802334	GGGGAAAGCAACCAAACGGAGGCTGAAGTGAAGTTACAAAGGTTACACTCTTGTGCAAATATCTGATTGGTTATGGACAGCAACCAGAGACTAAAGTGAAGTTACAAAGTTCCACTTCTATGCAAGCGTGTGATTGGTTGCAAAAAGCAACAAATTAGAGGTACTTTCAATTTCCCATTTGCCATGCAGAAAATGTGGGGGTTTGCAAAGGGAGTAGCGCCTGGTTCTTTTGTTACTTAGGCATGATGGAAAGTT	G	Deletion	Pathogenic	Combined_oxidative_phosphorylation_deficiency_48	SO:0001574\|splice_acceptor_variant,SO:0001575\|splice_donor_variant	SO:0001574\|splice_acceptor_variant,SO:0001575\|splice_donor_variant
NSUN3	chr3	93803123	C	T	single_nucleotide_variant	Pathogenic	Combined_oxidative_phosphorylation_deficiency_48	SO:0001587\|nonsense	SO:0001587\|nonsense
NSUN3	chr3	93803249	G	C	single_nucleotide_variant	Pathogenic	Combined_oxidative_phosphorylation_deficiency_48	SO:0001583\|missense_variant	SO:0001583\|missense_variant
NSUN3	chr3	93803282	T	A	single_nucleotide_variant	Pathogenic	Combined_oxidative_phosphorylation_deficiency_48	SO:0001583\|missense_variant	SO:0001583\|missense_variant
NSUN3	chr3	93803292	C	CA	Duplication	Likely_pathogenic	not_provided	SO:0001589\|frameshift_variant	SO:0001589\|frameshift_variant

nsSNVs with sample frequency (size of circle) from TCGA 33 cancers.

SNVs and Indels

Gene	Cancer type	Chromosome	Start	End	RefSeeq	MutSeq	Mutation type	AAchange	# samples
NSUN3	BRCA	chr3	93803063	93803063	C	T	Nonsense_Mutation	p.Q79*	4
NSUN3	UCS	chr3	93813928	93813928	G	A	Missense_Mutation	p.D225N	3
NSUN3	KIRP	chr3	93845254	93845254	G	T	Missense_Mutation	p.V315L	3
NSUN3	LUAD	chr3	93813893	93813893	C	T	Missense_Mutation	p.P213L	3
NSUN3	BRCA	chr3	93783283	93783283	G	C	Silent	p.L5	3
NSUN3	BRCA	chr3	93845211	93845211	C	G	Missense_Mutation	p.H300Q	3
NSUN3	ESCA	chr3	93813066	93813066	G	C	Missense_Mutation	p.L183F	3
NSUN3	STAD	chr3	93803031	93803031	A	G	Missense_Mutation	p.D68G	2
NSUN3	CESC	chr3	93813021	93813021	G	C	Missense_Mutation		2
NSUN3	LIHC	chr3	93845245	93845245	G	-	Frame_Shift_Del	p.G312fs	2
NSUN3	HNSC	chr3	93803120	93803120	G	A	Missense_Mutation	p.G98S	2
NSUN3	STAD	chr3	93803180	93803180	G	C	Missense_Mutation	p.A118P	2
NSUN3	LIHC	chr3	93845279	93845279	G	-	Frame_Shift_Del	p.W323fs	2
NSUN3	BLCA	chr3	93802971	93802971	C	G	Nonsense_Mutation	p.S48*	2
NSUN3	PAAD	chr3	93783283	93783283	G	A	Silent	p.L5L	2
NSUN3	LIHC	chr3	93802963	93802963	A	G	Silent		2
NSUN3	LIHC	chr3	93802963	93802963	A	G	Silent	p.T45T	2
NSUN3	UCEC	chr3	93803123	93803123	C	T	Nonsense_Mutation	p.R99*	2
NSUN3	HNSC	chr3	93781974	93781974	C	T	Silent	p.L2L	2
NSUN3	UCEC	chr3	93803192	93803192	C	A	Missense_Mutation	p.L122I	2
NSUN3	HNSC	chr3	93783306	93783306	T	A	Missense_Mutation	p.L13H	2
NSUN3	SKCM	chr3	93813945	93813945	C	T	Silent	p.S230S	2
NSUN3	UCEC	chr3	93845073	93845073	A	G	Silent	p.L254	2
NSUN3	HNSC	chr3	93783304	93783304	G	T	Missense_Mutation	p.K12N	2
NSUN3	SKCM	chr3	93781971	93781971	A	G	Missense_Mutation	p.M1V	2
NSUN3	CESC	chr3	93813015	93813015	G	C	Silent		2
NSUN3	LIHC	chr3	93845147	93845147	T	-	Frame_Shift_Del	p.I279fs	2
NSUN3	UCEC	chr3	93845075	93845075	G	T	Missense_Mutation	p.R255L	2
NSUN3	HNSC	chr3	93803224	93803224	G	T	Silent	p.G132G	1
NSUN3	UCS	chr3	93813928	93813928	G	A	Missense_Mutation		1
NSUN3	ESCA	chr3	93803065	93803065	G	T	Missense_Mutation	p.Q79H	1
NSUN3	LUAD	chr3	93812983	93812983	G	T	Splice_Site	p.G156_splice	1
NSUN3	STAD	chr3	93783344	93783345	-	A	Frame_Shift_Ins	p.E26fs	1
NSUN3	CESC	chr3	93813015	93813015	G	C	Silent	p.L166	1
NSUN3	GBM	chr3	93813043	93813043	G	C	Missense_Mutation	p.E176Q	1
NSUN3	LUSC	chr3	93845224	93845224	G	T	Missense_Mutation	p.A305S	1
NSUN3	STAD	chr3	93783345	93783346	-	A	Frame_Shift_Ins	p.E26fs	1
NSUN3	CESC	chr3	93813021	93813021	G	C	Missense_Mutation	p.L168F	1
NSUN3	LIHC	chr3	93803159	93803159	A	-	Frame_Shift_Del	p.K112fs	1
NSUN3	HNSC	chr3	93783304	93783304	G	T	Missense_Mutation		1
NSUN3	LUSC	chr3	93803157	93803157	T	A	Missense_Mutation	p.L110Q	1
NSUN3	KIRP	chr3	93845254	93845254	G	T	Missense_Mutation		1
NSUN3	THCA	chr3	93802955	93802956	AT	-	Frame_Shift_Del	p.I43fs	1
NSUN3	COAD	chr3	93803155	93803155	C	T	Silent	p.N109N	1
NSUN3	LIHC	chr3	93845299	93845299	A	-	Frame_Shift_Del	p.K330fs	1
NSUN3	HNSC	chr3	93783306	93783306	T	A	Missense_Mutation		1
NSUN3	LUSC	chr3	93803158	93803158	G	A	Silent	p.L110L	1
NSUN3	BLCA	chr3	93783294	93783294	C	T	Missense_Mutation		1
NSUN3	LIHC	chr3	93845062	93845062	A	G	Missense_Mutation		1
NSUN3	THYM	chr3	93845122	93845122	G	T	Nonsense_Mutation	p.E271X	1
NSUN3	COAD	chr3	93813134	93813134	A	G	Missense_Mutation	p.D206G	1
NSUN3	LUAD	chr3	93802949	93802949	A	T	Splice_Site		1
NSUN3	HNSC	chr3	93781974	93781974	C	T	Silent		1
NSUN3	PAAD	chr3	93783283	93783283	G	A	Silent		1
NSUN3	LIHC	chr3	93803011	93803011	T	C	Silent		1
NSUN3	UCEC	chr3	93845073	93845073	A	G	Silent	p.L254L	1
NSUN3	COAD	chr3	93803286	93803286	C	T	Missense_Mutation	p.A153V	1
NSUN3	LUAD	chr3	93845234	93845234	G	T	Missense_Mutation	p.G308V	1
NSUN3	HNSC	chr3	93803120	93803120	G	A	Missense_Mutation		1
NSUN3	BLCA	chr3	93783294	93783294	C	T	Missense_Mutation	p.S9L	1
NSUN3	UCEC	chr3	93803065	93803065	G	A	Silent	p.Q79Q	1
NSUN3	DLBC	chr3	93845062	93845062	A	G	Missense_Mutation	p.I251V	1
NSUN3	HNSC	chr3	93803224	93803224	G	T	Silent		1
NSUN3	PRAD	chr3	93803223	93803223	G	T	Missense_Mutation	p.G132V	1
NSUN3	ESCA	chr3	93795383	93795383	C	A	RNA	NULL	1
NSUN3	LUAD	chr3	93812983	93812983	G	T	Splice_Site		1
NSUN3	READ	chr3	93803060	93803060	T	A	Missense_Mutation	p.S78T	1
NSUN3	LIHC	chr3	93812983	93812983	G	T	Splice_Site	.	1
NSUN3	ESCA	chr3	93795412	93795412	G	T	RNA	NULL	1
NSUN3	LUAD	chr3	93845162	93845162	G	C	Missense_Mutation	p.G284A	1
NSUN3	LIHC	chr3	93813919	93813919	T	-	Frame_Shift_Del	p.F222fs	1
NSUN3	LUAD	chr3	93845109	93845109	G	A	Silent	p.T266T	1
NSUN3	ESCA	chr3	93813066	93813066	G	C	Missense_Mutation		1
NSUN3	LUAD	chr3	93802949	93802949	A	T	Splice_Site	p.R41_splice	1

Copy number variation (CNV) of NSUN3
* Click on the image to open the original image in a new window.

Fusion gene breakpoints (product of the structural variants (SVs)) across NSUN3
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion genes with this translation factor from FusionGDB2.0.

FusionGDB2 ID	Disease	Sample	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand
36017	STAD	TCGA-BR-8058-01A	APTX	chr9	32988081	-	NSUN3	chr3	93802951	+
36017	LUSC	TCGA-NC-A5HD-01A	ARL13B	chr3	93722752	+	NSUN3	chr3	93845055	+
36023	SARC	TCGA-DX-A8BR-01A	HECTD1	chr14	31617927	-	NSUN3	chr3	93800453	+
89169	ESCA	TCGA-LN-A49K	NSUN3	chr3	93813998	+	ALCAM	chr3	105238910	+
96258	N/A	CD674690	NSUN3	chr3	93846833	+	ASPH	chr8	62560042	-
98738	N/A	AF169972	NSUN3	chr3	93845631	+	CDK8	chr13	26893896	-
93484	N/A	AF351612	NSUN3	chr3	93804223	+	EZR	chr6	159221568	-
83984	STAD	TCGA-BR-A4PE	NSUN3	chr3	93813998	+	HGD	chr3	120371498	-
102084	Non-Cancer	TCGA-HU-A4GP-11A	NSUN3	chr3	93783390	+	SEC31A	chr4	83750211	-

Top

Prognostic Analysis

Kaplan-Meier plots with logrank tests of overall survival (OS)

Cancer type

Translation factor

Coefficent

Hazard ratio

Wald test pval

Likelihool ratio pval

Logrank test pval

# samples

Top

Translation factor and Gender

Differential gene expression between female and male. (Wilcoxon test, pval<0.05)

Cancer type	Translation factor	pval	adj.p
HNSC	NSUN3	0.000537540123267641	0.015
ACC	NSUN3	0.00200719759878059	0.054
LUAD	NSUN3	0.00316480072149138	0.082
STAD	NSUN3	0.00449613103919873	0.11
GBM	NSUN3	0.00509144745640982	0.12
THYM	NSUN3	0.0245069444445632	0.56
THCA	NSUN3	0.0286610534804987	0.63

Top

Translation factor and Age

Differential gene expression between young and old age groups (Wilcoxon test, pval<0.05)

Cancer type	Translation factor	pval	adj.p
STAD	NSUN3	0.0398205352477647	1
THCA	NSUN3	7.43588503471176e-05	0.0025
CHOL	NSUN3	0.0255086207691769	0.82

Top

Related Drugs

Drugs targeting genes involved in this translation factor.
(DrugBank Version 5.1.8 2021-05-08)

UniProtAcc

DrugBank ID

Drug name

Drug activity

Drug type

Drug status

Top

Related Diseases

Diseases associated with this translation factor.
(DisGeNet 4.0)

Disease ID

Disease Name

# PubMeds

Disease source