Home

Download

Statistics

Examples

Help

Contact

	Gene Summary
	Translation studies in PubMed
	Exon Skipping Events
	Expression
	Expression Regulation
	Associated Genes
	Protein 3D Structure
	Protein-Protein Interaction
	Mutations
	Prognostic Analysis
	Gender Association
	Age Association
	Related Drugs
	Related Diseases

Translation Factor: SOX4 (NCBI Gene ID:6659)

Gene Summary

Gene Summary

Gene Information	Gene Name: SOX4
	Gene ID: 6659
	Gene Symbol	SOX4
	Gene ID	6659
	Gene Name	SRY-box transcription factor 4
	Synonyms	CSS10\|EVI16
	Cytomap	6p22.3
	Type of Gene	protein-coding
	Description	transcription factor SOX-4SRY (sex determining region Y)-box 4SRY-box 4SRY-related HMG-box gene 4ecotropic viral integration site 16
	Modification date	20200329
	UniProtAcc	Q06945

Child GO biological process term(s) under GO:0006412

GO ID	GO term
GO:0006417	Regulation of translation
GO:0045727	Positive regulation of translation
GO:0006412	Translation

Gene ontology of translaction factor with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Hgene	SOX4	GO:0006355	regulation of transcription, DNA-templated	7706298\|16631117
Hgene	SOX4	GO:0042769	DNA damage response, detection of DNA damage	19234109
Hgene	SOX4	GO:0045893	positive regulation of transcription, DNA-templated	16631117\|19147588
Hgene	SOX4	GO:0045944	positive regulation of transcription by RNA polymerase II	19147588
Hgene	SOX4	GO:2000761	positive regulation of N-terminal peptidyl-lysine acetylation	19234109

Inferred gene age of translation factor.

Gene	Inferred gene age group among (0 - 67.6], (67.6 - 355.7], (355.7 - 733], (733 - 1119.25], >1119.25
SOX4	(733 - 1119.25]

Top

Translation Studies in PubMed

We searched PubMed using 'SOX4[title] AND translation [title] AND human.'

Gene	Title	PMID
SOX4	.	.

Top

Exon Skipping Events

Skipped exons in TCGA and GTEx based on Ensembl gene isoform structure.
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.
For more annotations, please visit our ExonSkipDB.

Open reading frame (ORF) analsis of exon skipping events based on Ensembl gene isoform structure.
* Click on the break point to see the gene structure around the break point region using the UCSC Genome Browser.

ENST

Exon skip start (DNA)

Exon Skip end (DNA)

ORF

Exon skipping position in the amino acid sequence.

ENST

Exon skip start (DNA)

Exon Skip end (DNA)

Len(transcript seq)

Exon skip start (mRNA)

Exon Skip end (mRNA)

Len(amino acid seq)

Exon skip start (AA)

Exon Skip end (AA)

Potentially (partially) lost protein functional features of UniProt.

UniProtAcc

Exon skip start (AA)

Exon Skip end (AA)

Function feature start (AA)

Function feature end (AA)

Functional feature type

Functional feature desc.

Top

Expression

Gene expression level across TCGA pancancer

Gene expression level across GTEx pantissue

Expression level of gene isoforms across TCGA pancancer

Expression level of gene isoforms across GTEx pantissue

Cancer(tissue) type-specific expression level of Translation factor using z-score distriution

Differential expression between tumor and matched normal (in the cancer types with more than 10 matched samples)

Cancer type	Translation factor	FC	adj.pval
KICH	SOX4	3.18022914335546	0.000489473342895508
HNSC	SOX4	-1.17365487670599	0.00277281553030662
KIRC	SOX4	1.22505441914547	0.00611943191985528
PRAD	SOX4	-6.290521627674	5.87919382481568e-07

Top

Expression Regulation

Translation factor expression regulation through miRNA binding

Cancer type	Gene	miRNA	TargetScan binding score (Context++ score percentile)	Coefficient	Pvalue
PAAD	SOX4	hsa-miR-132-3p	96	-0.306426484907498	0.00620928337471951

Translation factor expression regulation through methylation in the promoter of Translation factor

Cancer type

Gene

methyl group b

methyl group a

DEG pval

avg methyl in b

avg methyl in a

avg exp in b

avg exp in a

Translation factor expression regulation through methylation in the gene body of Translation factor (positive regulation)

Cancer type

Gene

methyl group b

methyl group a

DEG pval

avg methyl in b

avg methyl in a

avg exp in b

avg exp in a

Translation factor expression regulation through copy number variation of Translation factor

Cancer type	Gene	Coefficient	Pvalue
LIHC	SOX4	-0.058791903	0.026892548

Top

Associated Genes

Strongly correlated genes belong to cellular important gene groups with SOX4 (coefficient>0.8, pval<0.05, node color based on FC between tumor and matched normal). Significantly associated important genes in the individual cancer types. * Cell metabolism gene: cell metabolism genes from REACTOME (black edge), IUPHAR: drug target genes from IUPHAR (blue edge), Kinase: human kinase genes (brown edge), CGC: cancer gene census genes (orange edge), TSG: tumor suppresor genes (purple edge), Epifactor: epigenetic factors (light blue edge), TF: transcription factors (green)

Cancer type	Gene group	Translation factor	Correlated gene	Coefficient	Pvalue
CHOL	Cell metabolism gene	SOX4	INPP5J	0.806665872	2.24E-11
CHOL	Cell metabolism gene	SOX4	TEAD2	0.822448487	4.24E-12
CHOL	Cell metabolism gene	SOX4	DNMT3A	0.826694314	2.64E-12
CHOL	Cell metabolism gene	SOX4	PPAP2C	0.845656398	2.67E-13
CHOL	CGC	SOX4	ETV4	0.800610813	4.07E-11
CHOL	CGC	SOX4	MN1	0.816898634	7.75E-12
CHOL	CGC	SOX4	DNMT3A	0.826694314	2.64E-12
CHOL	CGC	SOX4	SRC	0.837426429	7.48E-13
CHOL	Epifactor	SOX4	CTBP2	0.811759884	1.33E-11
CHOL	Epifactor	SOX4	DNMT3A	0.826694314	2.64E-12
CHOL	IUPHAR	SOX4	INPP5J	0.806665872	2.24E-11
CHOL	IUPHAR	SOX4	ITGB4	0.826185569	2.79E-12
CHOL	IUPHAR	SOX4	DNMT3A	0.826694314	2.64E-12
CHOL	IUPHAR	SOX4	CSNK1E	0.834328488	1.09E-12
CHOL	IUPHAR	SOX4	SRC	0.837426429	7.48E-13
CHOL	Kinase	SOX4	CSNK1E	0.834328488	1.09E-12
CHOL	Kinase	SOX4	SRC	0.837426429	7.48E-13
CHOL	TF	SOX4	ETV4	0.800610813	4.07E-11
CHOL	TF	SOX4	SOX9	0.811644329	1.35E-11
CHOL	TF	SOX4	TEAD2	0.822448487	4.24E-12
CHOL	TF	SOX4	TFAP2A	0.880407534	1.59E-15
CHOL	TF	SOX4	OVOL2	0.882787842	1.06E-15
CHOL	TSG	SOX4	RAB25	0.813373366	1.12E-11
CHOL	TSG	SOX4	JUP	0.8232528	3.88E-12
CHOL	TSG	SOX4	DNMT3A	0.826694314	2.64E-12
CHOL	TSG	SOX4	SFN	0.828312966	2.19E-12
CHOL	TSG	SOX4	ESRP1	0.853633041	9.28E-14
CHOL	TSG	SOX4	TFAP2A	0.880407534	1.59E-15
GBM	Epifactor	SOX4	CBX2	0.801608496	7.97E-40
GBM	TF	SOX4	CBX2	0.801608496	7.97E-40
GBM	TF	SOX4	SOX11	0.830461539	4.69E-45
GBM	TSG	SOX4	SOX11	0.830461539	4.69E-45
THCA	CGC	SOX4	ELF3	0.81560189	1.49E-137
THCA	CGC	SOX4	RUNX1	0.818493904	2.58E-139
THCA	IUPHAR	SOX4	EPHB3	0.800981599	4.21E-129
THCA	IUPHAR	SOX4	CD276	0.803685817	1.30E-130
THCA	Kinase	SOX4	EPHB3	0.800981599	4.21E-129
THCA	TF	SOX4	ELF3	0.81560189	1.49E-137
THCA	TF	SOX4	RUNX1	0.818493904	2.58E-139
THCA	TSG	SOX4	EPHB3	0.800981599	4.21E-129
THCA	TSG	SOX4	RUNX1	0.818493904	2.58E-139
THYM	Cell metabolism gene	SOX4	DNMT3A	0.865542724	7.70E-38
THYM	CGC	SOX4	DNMT3A	0.865542724	7.70E-38
THYM	Epifactor	SOX4	DNMT3A	0.865542724	7.70E-38
THYM	IUPHAR	SOX4	DNMT3A	0.865542724	7.70E-38
THYM	TSG	SOX4	DNMT3A	0.865542724	7.70E-38
UCS	Cell metabolism gene	SOX4	DNMT3A	0.865542724	7.70E-38
UCS	CGC	SOX4	DNMT3A	0.865542724	7.70E-38
UCS	Epifactor	SOX4	DNMT3A	0.865542724	7.70E-38
UCS	IUPHAR	SOX4	DNMT3A	0.865542724	7.70E-38
UCS	TSG	SOX4	DNMT3A	0.865542724	7.70E-38

Top

Protein structure

Protein 3D structure
Visit iCn3D.

Top

Protein-Protein Interaction

Protein-protein interaction networks
* Overlap between up-regulated DEGs (log2FC<-1 and adj.P<0.05) and STRING PPI network (center: Translation factor, node: DEGs, edges: weighted by -log2(adj.P))

Overlap between down-regulated DEGs (log2FC>1 and adj.P<0.05) and STRING PPI network (center: Translation factor, node: DEGs, edges: weighted by -log2(adj.P))

* Edge colors based on TCGA cancer types.

* Overlap between DEGs (log2FC>1 and adj.P<0.05) and STRING PPI network per cancer (center: Translation factor, node: DEGs, node color: log2FC, edges: weighted by -log2(adj.P))

Cancer type	Translation factor	Interacting protein coding gene	FC	adj.pval
KICH	SOX4	CTNNB1	1.35387002426383	0.000139892101287842
KIRP	SOX4	CTNNB1	1.44413647030576	0.00019507110118866
LIHC	SOX4	POU5F1	-4.77673145264574	0.000263325268073385
STAD	SOX4	TCF7	2.21952816618939	0.000557802151888609
HNSC	SOX4	POU5F1	-1.82253221062701	0.0014147440645047
CHOL	SOX4	LEF1	-2.89030081427577	0.00390625
LUSC	SOX4	CTNNB1	-1.53686315879634	0.00765883184752251
KICH	SOX4	TCF7	-2.0229286708491	0.00806879997253418
UCEC	SOX4	LEF1	3.3808409868998	0.015625
UCEC	SOX4	TP53	2.03295038376694	0.015625
BLCA	SOX4	IL5RA	2.63030540877847	0.0186868755048476
CHOL	SOX4	SDCBP	1.78886811078003	0.02734375
PRAD	SOX4	LEF1	-1.92964004675333	0.0305494319135424
HNSC	SOX4	LEF1	-2.88955047406199	0.0410440647583528
PRAD	SOX4	KLF5	-2.8165933740312	1.3703887201148e-05
LUAD	SOX4	IL5RA	-1.08027464296074	1.40344625376287e-07
KIRC	SOX4	EZH2	-1.25357813515858	1.51030756644924e-12
LUSC	SOX4	IL5RA	-2.03127613589264	1.52972791191717e-09
LIHC	SOX4	LEF1	-1.42162620000502	1.86041017272598e-07
LUAD	SOX4	LEF1	-1.91639189459241	2.05995321697677e-05
KIRC	SOX4	KLF5	3.6056250591816	2.99111716929276e-12
KIRP	SOX4	LEF1	1.61219322897908	3.51201742887497e-06
KICH	SOX4	UBE2I	-5.44872614717543	4.17232513427734e-07
LUAD	SOX4	SDCBP	-1.49919537414871	4.39225939988757e-09
KIRC	SOX4	POU5F1	1.60944809981704	4.4523606197609e-12
KIRC	SOX4	TP53	-1.43050981150632	4.58942580328929e-09
KIRP	SOX4	EZH2	-1.27667812880901	4.6566128730774e-09
KIRP	SOX4	UBE2I	-3.59049157115081	4.6566128730774e-10
LUAD	SOX4	EZH2	-5.81983405381301	4.67307812889392e-11
THCA	SOX4	TP53	-1.81960143635647	6.18215597921662e-07
KIRC	SOX4	UBE2I	-1.41416662536884	8.54581888974811e-13
LIHC	SOX4	EZH2	-2.67323064920817	9.93036701162759e-10

Protein-protein interactors with this translation factor (BIOGRID-3.4.160)

PPI interactors with SOX4

SDCBP, tat, TP53, MDM2, EP300, ELAVL1, UBE2I, TAF5, TNNI3, SCNN1G, MINPP1, IGF1, PLD3, CAPN15, FOXH1, RGSL1, LMNB2, CTR9, ITIH1, APOC3, EDF1, NANOGNB, MNT, PLXNB1, RP1L1, BANF1, RHOU, USP15, SPAG9, MCM2, MCM4, MCM6, EPS15L1, AURKA, CDKN2A, DACH1, WHSC1L1, AKT1, FZR1, KRAS, MYC, NF1, NF2, SMARCA4, STK11, TERT, TSC1, WT1, FASN, ACTBL2, MYO1B, TAF5L, SEC16A, MRPS12, ABCD3, CASP14, USP11, TFAM, ECH1, PWP1, CUX1, HAGH, FILIP1L, TADA2B, PBRM1, SUPT20H, EP400, POLDIP3, GTPBP4, CALML5, UBE2M, POLDIP2, STRAP,

Top

Mutations

Clinically associated variants from ClinVar.

Gene	Chr	Position	RefSeq	VarSeq	RefSeeq	VarType	Pathogenic	Disease	VarInfo
SOX4	chr6	21594201	C	A	single_nucleotide_variant	Benign	not_provided	SO:0001623\|5_prime_UTR_variant	SO:0001623\|5_prime_UTR_variant
SOX4	chr6	21594847	C	G	single_nucleotide_variant	Benign	not_provided	SO:0001583\|missense_variant	SO:0001583\|missense_variant
SOX4	chr6	21594895	G	T	single_nucleotide_variant	Uncertain_significance	Neurodevelopmental_disorder	SO:0001583\|missense_variant	SO:0001583\|missense_variant
SOX4	chr6	21594941	T	G	single_nucleotide_variant	Pathogenic/Likely_pathogenic	Mild_facial_and_digital_morphological_abnormalities\|Intellectual_disability\|Coffin-Siris_syndrome_10\|Developmental_delay	SO:0001583\|missense_variant	SO:0001583\|missense_variant
SOX4	chr6	21594947	G	A	single_nucleotide_variant	Likely_pathogenic	not_provided	SO:0001583\|missense_variant	SO:0001583\|missense_variant
SOX4	chr6	21594958	G	A	single_nucleotide_variant	Uncertain_significance	Coffin-Siris_syndrome_10	SO:0001583\|missense_variant	SO:0001583\|missense_variant
SOX4	chr6	21594963	C	A	single_nucleotide_variant	Likely_pathogenic	Mild_facial_and_digital_morphological_abnormalities\|Intellectual_disability\|Intellectual_disability,_mild\|Coffin-Siris_syndrome_10\|Developmental_delay	SO:0001583\|missense_variant	SO:0001583\|missense_variant
SOX4	chr6	21594978	G	A	single_nucleotide_variant	Likely_benign	not_provided	SO:0001819\|synonymous_variant	SO:0001819\|synonymous_variant
SOX4	chr6	21595043	T	A	single_nucleotide_variant	Uncertain_significance	not_provided	SO:0001583\|missense_variant	SO:0001583\|missense_variant
SOX4	chr6	21595080	G	T	single_nucleotide_variant	Pathogenic/Likely_pathogenic	Mild_facial_and_digital_morphological_abnormalities\|Intellectual_disability\|Coffin-Siris_syndrome_10\|Developmental_delay	SO:0001583\|missense_variant	SO:0001583\|missense_variant
SOX4	chr6	21595087	T	TA	Insertion	Uncertain_significance	Coffin-Siris_syndrome_10	SO:0001589\|frameshift_variant	SO:0001589\|frameshift_variant
SOX4	chr6	21595099	G	C	single_nucleotide_variant	Pathogenic/Likely_pathogenic	Mild_facial_and_digital_morphological_abnormalities\|Intellectual_disability\|Coffin-Siris_syndrome_10\|Developmental_delay	SO:0001583\|missense_variant	SO:0001583\|missense_variant
SOX4	chr6	21595104	G	A	single_nucleotide_variant	Benign	not_provided	SO:0001819\|synonymous_variant	SO:0001819\|synonymous_variant
SOX4	chr6	21595167	G	C	single_nucleotide_variant	Likely_benign	not_provided	SO:0001819\|synonymous_variant	SO:0001819\|synonymous_variant
SOX4	chr6	21595231	G	C	single_nucleotide_variant	Uncertain_significance	SOX4-related_neurodevelopmental_disorder	SO:0001583\|missense_variant	SO:0001583\|missense_variant
SOX4	chr6	21595251	C	T	single_nucleotide_variant	Likely_benign	not_provided	SO:0001819\|synonymous_variant	SO:0001819\|synonymous_variant
SOX4	chr6	21595266	G	GGGC	Microsatellite	Benign	not_provided	SO:0001821\|inframe_insertion	SO:0001821\|inframe_insertion
SOX4	chr6	21595452	A	G	single_nucleotide_variant	Benign	not_provided	SO:0001819\|synonymous_variant	SO:0001819\|synonymous_variant
SOX4	chr6	21595459	GCCGCCGCCGCCT	G	Deletion	Uncertain_significance	Coffin-Siris_syndrome_10	SO:0001822\|inframe_deletion	SO:0001822\|inframe_deletion
SOX4	chr6	21595465	G	C	single_nucleotide_variant	Uncertain_significance	Coffin-Siris_syndrome_10	SO:0001583\|missense_variant	SO:0001583\|missense_variant
SOX4	chr6	21595494	GGCCGCCGCCCTGCTGCCCCTGGGC	G	Deletion	Uncertain_significance	Intellectual_disability	SO:0001822\|inframe_deletion	SO:0001822\|inframe_deletion
SOX4	chr6	21595511	C	A	single_nucleotide_variant	Uncertain_significance	Coffin-Siris_syndrome_10	SO:0001583\|missense_variant	SO:0001583\|missense_variant
SOX4	chr6	21595575	C	G	single_nucleotide_variant	Likely_benign	not_provided	SO:0001819\|synonymous_variant	SO:0001819\|synonymous_variant
SOX4	chr6	21595589	C	T	single_nucleotide_variant	Uncertain_significance	Disorder_of_sex_development	SO:0001583\|missense_variant	SO:0001583\|missense_variant
SOX4	chr6	21595779	C	T	single_nucleotide_variant	Likely_benign	not_provided	SO:0001819\|synonymous_variant	SO:0001819\|synonymous_variant
SOX4	chr6	21595805	C	A	single_nucleotide_variant	Likely_pathogenic	Coffin-Siris_syndrome_10	SO:0001587\|nonsense	SO:0001587\|nonsense
SOX4	chr6	21595840	C	T	single_nucleotide_variant	Uncertain_significance	not_provided	SO:0001583\|missense_variant	SO:0001583\|missense_variant
SOX4	chr6	21595919	ACTC	A	Microsatellite	Benign	not_provided	SO:0001822\|inframe_deletion	SO:0001822\|inframe_deletion
SOX4	chr6	21595923	C	T	single_nucleotide_variant	Benign	not_provided	SO:0001819\|synonymous_variant	SO:0001819\|synonymous_variant
SOX4	chr6	21595949	C	A	single_nucleotide_variant	Uncertain_significance	not_provided	SO:0001587\|nonsense	SO:0001587\|nonsense
SOX4	chr6	21595980	G	C	single_nucleotide_variant	Benign	not_provided	SO:0001819\|synonymous_variant	SO:0001819\|synonymous_variant
SOX4	chr6	21596072	T	TC	Duplication	Uncertain_significance	Coffin-Siris_syndrome_10	SO:0001589\|frameshift_variant	SO:0001589\|frameshift_variant
SOX4	chr6	21596349	ATC	A	Deletion	Benign	not_provided	SO:0001624\|3_prime_UTR_variant	SO:0001624\|3_prime_UTR_variant

nsSNVs with sample frequency (size of circle) from TCGA 33 cancers.

SNVs and Indels

Gene	Cancer type	Chromosome	Start	End	RefSeeq	MutSeq	Mutation type	AAchange	# samples
SOX4	BLCA	chr6	21596141	21596141	C	G	Missense_Mutation	p.S459W	4
SOX4	LUAD	chr6	21595266	21595267	-	GGC	In_Frame_Ins	p.167_168GR>GAR	3
SOX4	KIRC	chr6	21594792	21594792	G	C	Missense_Mutation	p.E9D	2
SOX4	SKCM	chr6	21595096	21595096	G	A	Missense_Mutation	p.E111K	2
SOX4	LGG	chr6	21594838	21594838	G	T	Missense_Mutation	p.G25C	2
SOX4	UCEC	chr6	21595042	21595042	C	T	Silent	p.L93	2
SOX4	STAD	chr6	21595667	21595667	G	A	Missense_Mutation	p.G301D	2
SOX4	TGCT	chr6	21595997	21595997	G	A	Missense_Mutation		2
SOX4	LGG	chr6	21595267	21595269	GGC	-	In_Frame_Del	p.G173del	2
SOX4	HNSC	chr6	21596066	21596066	T	G	Missense_Mutation	p.F434C	2
SOX4	BLCA	chr6	21595158	21595158	G	A	Silent	p.R131R	2
SOX4	KIRC	chr6	21595027	21595027	G	A	Missense_Mutation	p.E88K	2
SOX4	THYM	chr6	21595042	21595042	C	T	Silent	p.L93L	2
SOX4	BLCA	chr6	21595252	21595263	GGGGGCGGCCAT	-	In_Frame_Del	p.GGGH163del	2
SOX4	THYM	chr6	21595973	21595974	-	CGAC	Frame_Shift_Ins	p.D403fs	1
SOX4	LIHC	chr6	21595211	21595211	C	T	Missense_Mutation	p.S149F	1
SOX4	BLCA	chr6	21595158	21595158	G	T	Missense_Mutation	p.R131S	1
SOX4	SARC	chr6	21595992	21595992	C	-	Frame_Shift_Del	p.S411fs	1
SOX4	KIRP	chr6	21594835	21594835	G	T	Missense_Mutation	p.A24S	1
SOX4	THYM	chr6	21595100	21595100	C	T	Missense_Mutation	p.A112V	1
SOX4	LIHC	chr6	21594807	21594807	G	A	Silent	p.L14L	1
SOX4	CESC	chr6	21595975	21595975	G	T	Missense_Mutation		1
SOX4	THYM	chr6	21595973	21595974	-	CGAC	Frame_Shift_Ins	p.G403fs	1
SOX4	LUAD	chr6	21596142	21596142	G	T	Silent	p.S459S	1
SOX4	COAD	chr6	21594847	21594847	C	G	Missense_Mutation	p.L28V	1
SOX4	SKCM	chr6	21596018	21596018	C	T	Missense_Mutation	p.S418F	1
SOX4	LGG	chr6	21596085	21596085	C	T	Silent	p.S440S	1
SOX4	THYM	chr6	21595973	21595974	-	CGAC	Frame_Shift_Ins	p.L405fs	1
SOX4	BLCA	chr6	21596111	21596111	A	G	Missense_Mutation		1
SOX4	COAD	chr6	21595064	21595064	T	G	Missense_Mutation	p.L100R	1
SOX4	SKCM	chr6	21595725	21595725	C	T	Silent	p.D320D	1
SOX4	LGG	chr6	21595117	21595117	A	G	Missense_Mutation	p.K118E	1
SOX4	BLCA	chr6	21595094	21595094	G	C	Missense_Mutation		1
SOX4	LUSC	chr6	21595968	21595968	C	G	Missense_Mutation	p.F401L	1
SOX4	COAD	chr6	21598720	21598720	G	-	3'UTR	.	1
SOX4	LGG	chr6	21595157	21595157	G	T	Missense_Mutation	p.R131M	1
SOX4	BLCA	chr6	21596111	21596111	A	G	Missense_Mutation	p.Y449C	1
SOX4	PAAD	chr6	21595920	21595922	CTC	-	In_Frame_Del	p.HS385del	1
SOX4	GBM	chr6	21595085	21595085	C	T	Missense_Mutation	p.P107L	1
SOX4	LGG	chr6	21594926	21594926	C	-	Frame_Shift_Del	p.T54fs	1
SOX4	BLCA	chr6	21595094	21595094	G	C	Missense_Mutation	p.R110P	1
SOX4	PCPG	chr6	21595016	21595016	T	-	Frame_Shift_Del	p.M84fs	1
SOX4	HNSC	chr6	21596066	21596066	T	G	Missense_Mutation		1
SOX4	THYM	chr6	21595973	21595974	-	-	Frame_Shift_Ins		1
SOX4	BLCA	chr6	21596103	21596103	C	T	Silent	p.F446F	1
SOX4	READ	chr6	21595968	21595968	C	T	Silent	p.F401F	1
SOX4	THYM	chr6	21595100	21595100	C	T	Missense_Mutation		1
SOX4	LGG	chr6	21595634	21595636	AGA	-	In_Frame_Del	p.EK290del	1
SOX4	SARC	chr6	21595038	21595038	G	T	Missense_Mutation		1
SOX4	THYM	chr6	21595042	21595042	C	T	Silent		1
SOX4	HNSC	chr6	21595659	21595659	G	T	Silent	p.L298L	1
SOX4	LGG	chr6	21594934	21594934	G	-	Frame_Shift_Del	p.G57fs	1
SOX4	SARC	chr6	21595992	21595992	C	-	Frame_Shift_Del		1
SOX4	LGG	chr6	21594838	21594838	G	T	Missense_Mutation		1
SOX4	SARC	chr6	21595992	21595992	C	-	Frame_Shift_Del	p.N409fs	1

Copy number variation (CNV) of SOX4
* Click on the image to open the original image in a new window.

Fusion gene breakpoints (product of the structural variants (SVs)) across SOX4
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion genes with this translation factor from FusionGDB2.0.

FusionGDB2 ID	Disease	Sample	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand
85319	N/A	BX478866	ATP1A3	chr19	42470950	+	SOX4	chr6	21596930	+
85319	N/A	AK091397	C2CD3	chr11	73753123	-	SOX4	chr6	21597111	+
85319	N/A	AA533386	RUNDC3B	chr7	87418040	+	SOX4	chr6	21594372	-
85319	N/A	EC444951	SF3A3	chr1	38455643	-	SOX4	chr6	21597133	+
102061	N/A	DB315449	SOX4	chr6	21597111	-	C2CD3	chr11	73753123	+
102810	TGCT	TCGA-2G-AAF4-01A	SOX4	chr6	21598847	-	FOXP1	chr3	71007472	-
91133	N/A	AW139952	SOX4	chr6	21596382	-	GNG7	chr19	2605219	-
102989	N/A	BF590156	SOX4	chr6	21595892	+	PSMD14	chr2	162268139	-
85320	N/A	AI817673	SOX4	chr6	21595876	+	SOX4	chr6	21594747	+
85320	N/A	AI942449	SOX4	chr6	21595055	+	SOX4	chr6	21594026	+
85320	N/A	AW207656	SOX4	chr6	21594242	-	SOX4	chr6	21596676	-
85320	N/A	BI088114	SOX4	chr6	21598385	-	SOX4	chr6	21598430	+
85320	N/A	BU676818	SOX4	chr6	21597133	-	SOX4	chr6	21597073	+
85320	N/A	AA909038	SOX4	chr6	21597104	-	TNNC1	chr3	52486493	+

Top

Prognostic Analysis

Kaplan-Meier plots with logrank tests of overall survival (OS)

Cancer type

Translation factor

Coefficent

Hazard ratio

Wald test pval

Likelihool ratio pval

Logrank test pval

# samples

Top

Translation factor and Gender

Differential gene expression between female and male. (Wilcoxon test, pval<0.05)

Cancer type	Translation factor	pval	adj.p
TGCT	SOX4	0.000354742782460745	0.0099
KIRC	SOX4	0.00657691172351905	0.18
SARC	SOX4	0.0366885980634003	0.95
LIHC	SOX4	0.0392163026343599	0.98
BLCA	SOX4	0.0395608155352114	0.98
HNSC	SOX4	0.0431056348550211	0.99
LAML	SOX4	0.0443302097313077	0.99
GBM	SOX4	0.0473389071907813	0.99

Top

Translation factor and Age

Differential gene expression between young and old age groups (Wilcoxon test, pval<0.05)

Cancer type	Translation factor	pval	adj.p
LIHC	SOX4	0.000987107107760128	0.03
LGG	SOX4	0.00015437613141374	0.0049
BRCA	SOX4	2.38689326453974e-06	7.9e-05
PAAD	SOX4	0.0252961600425126	0.71
OV	SOX4	0.0364538894383308	0.98
CESC	SOX4	0.00028158190609114	0.0087
THYM	SOX4	0.0155904379845642	0.45

Top

Related Drugs

Drugs targeting genes involved in this translation factor.
(DrugBank Version 5.1.8 2021-05-08)

UniProtAcc

DrugBank ID

Drug name

Drug activity

Drug type

Drug status

Top

Related Diseases

Diseases associated with this translation factor.
(DisGeNet 4.0)

Disease ID	Disease Name	# PubMeds	Disease source
C0010606	Adenoid Cystic Carcinoma	1	CTD_human
C0018801	Heart failure	1	CTD_human
C0018802	Congestive heart failure	1	CTD_human
C0019207	Hepatoma, Morris	1	CTD_human
C0019208	Hepatoma, Novikoff	1	CTD_human
C0023212	Left-Sided Heart Failure	1	CTD_human
C0023893	Liver Cirrhosis, Experimental	1	CTD_human
C0086404	Experimental Hepatoma	1	CTD_human
C0220636	Malignant neoplasm of salivary gland	1	CTD_human
C0235527	Heart Failure, Right-Sided	1	CTD_human
C0265338	Coffin-Siris syndrome	1	ORPHANET
C0557874	Global developmental delay	1	GENOMICS_ENGLAND
C1850049	Clinodactyly of the 5th finger	1	GENOMICS_ENGLAND
C1959583	Myocardial Failure	1	CTD_human