Home

Download

Statistics

Examples

Help

Contact

	Gene Summary
	Translation studies in PubMed
	Exon Skipping Events
	Expression
	Expression Regulation
	Associated Genes
	Protein 3D Structure
	Protein-Protein Interaction
	Mutations
	Prognostic Analysis
	Gender Association
	Age Association
	Related Drugs
	Related Diseases

Translation Factor: PNPT1 (NCBI Gene ID:87178)

Gene Summary

Gene Summary

Gene Information	Gene Name: PNPT1
	Gene ID: 87178
	Gene Symbol	PNPT1
	Gene ID	87178
	Gene Name	polyribonucleotide nucleotidyltransferase 1
	Synonyms	COXPD13\|DFNB70\|OLD35\|PNPASE\|old-35
	Cytomap	2p16.1
	Type of Gene	protein-coding
	Description	polyribonucleotide nucleotidyltransferase 1, mitochondrial3'-5' RNA exonuclease OLD35PNPase 1PNPase old-35polynucleotide phosphorylase 1polynucleotide phosphorylase-like protein
	Modification date	20200313
	UniProtAcc	Q8TCS8

Child GO biological process term(s) under GO:0006412

GO ID	GO term
GO:0017148	Negative regulation of translation
GO:0006417	Regulation of translation
GO:0005840	Ribosome
GO:0006412	Translation

Gene ontology of translaction factor with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Hgene	PNPT1	GO:0000957	mitochondrial RNA catabolic process	18501193
Hgene	PNPT1	GO:0000958	mitochondrial mRNA catabolic process	20691904
Hgene	PNPT1	GO:0000962	positive regulation of mitochondrial RNA catabolic process	19509288\|29967381
Hgene	PNPT1	GO:0006401	RNA catabolic process	18083836
Hgene	PNPT1	GO:0006402	mRNA catabolic process	12721301\|16055741
Hgene	PNPT1	GO:0034599	cellular response to oxidative stress	18501193
Hgene	PNPT1	GO:0035458	cellular response to interferon-beta	16410805
Hgene	PNPT1	GO:0035927	RNA import into mitochondrion	20691904
Hgene	PNPT1	GO:0035928	rRNA import into mitochondrion	20691904
Hgene	PNPT1	GO:0043631	RNA polyadenylation	18083836
Hgene	PNPT1	GO:0045926	negative regulation of growth	12721301
Hgene	PNPT1	GO:0051260	protein homooligomerization	20691904
Hgene	PNPT1	GO:0070207	protein homotrimerization	19509288\|20691904
Hgene	PNPT1	GO:0071042	nuclear polyadenylation-dependent mRNA catabolic process	16934922
Hgene	PNPT1	GO:0071850	mitotic cell cycle arrest	12721301
Hgene	PNPT1	GO:2000627	positive regulation of miRNA catabolic process	20547861
Hgene	PNPT1	GO:2000772	regulation of cellular senescence	16055741

Inferred gene age of translation factor.

Gene	Inferred gene age group among (0 - 67.6], (67.6 - 355.7], (355.7 - 733], (733 - 1119.25], >1119.25
PNPT1	>1119.25

Top

Translation Studies in PubMed

We searched PubMed using 'PNPT1[title] AND translation [title] AND human.'

Gene	Title	PMID
PNPT1	.	.

Top

Exon Skipping Events

Skipped exons in TCGA and GTEx based on Ensembl gene isoform structure.
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.
For more annotations, please visit our ExonSkipDB.

Open reading frame (ORF) analsis of exon skipping events based on Ensembl gene isoform structure.
* Click on the break point to see the gene structure around the break point region using the UCSC Genome Browser.

ENST	Exon skip start (DNA)	Exon Skip end (DNA)	ORF
ENST00000447944	55864686	55864734	In-frame
ENST00000447944	55867761	55867840	Frame-shift
ENST00000447944	55871771	55871855	In-frame
ENST00000447944	55873549	55873621	In-frame
ENST00000447944	55874481	55874588	Frame-shift
ENST00000447944	55882034	55882088	In-frame
ENST00000447944	55883439	55883506	Frame-shift
ENST00000447944	55887291	55887328	Frame-shift
ENST00000447944	55889090	55889161	Frame-shift
ENST00000447944	55894996	55895093	Frame-shift
ENST00000447944	55900027	55900214	Frame-shift
ENST00000447944	55907846	55907894	In-frame

Exon skipping position in the amino acid sequence.

ENST	Exon skip start (DNA)	Exon Skip end (DNA)	Len(transcript seq)	Exon skip start (mRNA)	Exon Skip end (mRNA)	Len(amino acid seq)	Exon skip start (AA)	Exon Skip end (AA)
ENST00000447944	55864686	55864734	4428	2236	2283	783	716	732
ENST00000447944	55871771	55871855	4428	1910	1993	783	607	635
ENST00000447944	55873549	55873621	4428	1690	1761	783	534	558
ENST00000447944	55882034	55882088	4428	1529	1582	783	480	498
ENST00000447944	55907846	55907894	4428	605	652	783	172	188

Potentially (partially) lost protein functional features of UniProt.

UniProtAcc	Exon skip start (AA)	Exon Skip end (AA)	Function feature start (AA)	Function feature end (AA)	Functional feature type	Functional feature desc.
Q8TCS8	716	732	46	783	Chain	ID=PRO_0000024751;Note=Polyribonucleotide nucleotidyltransferase 1%2C mitochondrial
Q8TCS8	172	188	46	783	Chain	ID=PRO_0000024751;Note=Polyribonucleotide nucleotidyltransferase 1%2C mitochondrial
Q8TCS8	480	498	46	783	Chain	ID=PRO_0000024751;Note=Polyribonucleotide nucleotidyltransferase 1%2C mitochondrial
Q8TCS8	534	558	46	783	Chain	ID=PRO_0000024751;Note=Polyribonucleotide nucleotidyltransferase 1%2C mitochondrial
Q8TCS8	607	635	46	783	Chain	ID=PRO_0000024751;Note=Polyribonucleotide nucleotidyltransferase 1%2C mitochondrial
Q8TCS8	607	635	605	664	Domain	Note=KH;Ontology_term=ECO:0000255;evidence=ECO:0000255\|PROSITE-ProRule:PRU00117
Q8TCS8	716	732	679	750	Domain	Note=S1 motif;Ontology_term=ECO:0000255;evidence=ECO:0000255\|PROSITE-ProRule:PRU00180
Q8TCS8	534	558	552	552	Modified residue	Note=N6-succinyllysine;Ontology_term=ECO:0000250;evidence=ECO:0000250\|UniProtKB:Q8K1R3
Q8TCS8	480	498	484	484	Mutagenesis	Note=Inhibits poly(A) polymerase and RNA degradation activities. Does not inhibit the import or stabilization of RNase P RNA into the mitochondrial matrix. Does not inhibit homotrimerization activity. S->A;Ontology_term=ECO:0000269;evidence=ECO:0000269\|PubMed:20691904;Dbxref=PMID:20691904
Q8TCS8	534	558	544	544	Mutagenesis	Note=Stimulates in vitro poly(A) polymerase activity. Inhibits RNA degradation activity. Inhibits the import or stabilization of RNase P RNA into the mitochondrial matrix. Does not inhibit homotrimerization activity. D->A;Ontology_term=ECO:0000269;evidence=ECO:0000269\|PubMed:20691904;Dbxref=PMID:20691904
Q8TCS8	172	188	165	179	Helix	Ontology_term=ECO:0000244;evidence=ECO:0000244\|PDB:3U1K
Q8TCS8	172	188	180	182	Beta strand	Ontology_term=ECO:0000244;evidence=ECO:0000244\|PDB:3U1K
Q8TCS8	480	498	483	497	Helix	Ontology_term=ECO:0000244;evidence=ECO:0000244\|PDB:3U1K
Q8TCS8	534	558	535	539	Helix	Ontology_term=ECO:0000244;evidence=ECO:0000244\|PDB:3U1K
Q8TCS8	534	558	541	549	Beta strand	Ontology_term=ECO:0000244;evidence=ECO:0000244\|PDB:3U1K
Q8TCS8	534	558	554	561	Beta strand	Ontology_term=ECO:0000244;evidence=ECO:0000244\|PDB:3U1K
Q8TCS8	607	635	606	611	Beta strand	Ontology_term=ECO:0000244;evidence=ECO:0000244\|PDB:3U1K
Q8TCS8	607	635	614	621	Helix	Ontology_term=ECO:0000244;evidence=ECO:0000244\|PDB:3U1K
Q8TCS8	607	635	623	625	Helix	Ontology_term=ECO:0000244;evidence=ECO:0000244\|PDB:3U1K
Q8TCS8	607	635	626	635	Helix	Ontology_term=ECO:0000244;evidence=ECO:0000244\|PDB:3U1K

Top

Expression

Gene expression level across TCGA pancancer

Gene expression level across GTEx pantissue

Expression level of gene isoforms across TCGA pancancer

Expression level of gene isoforms across GTEx pantissue

Cancer(tissue) type-specific expression level of Translation factor using z-score distriution

Differential expression between tumor and matched normal (in the cancer types with more than 10 matched samples)

Cancer type	Translation factor	FC	adj.pval
KICH	PNPT1	1.84455116577408	0.000187873840332031
LIHC	PNPT1	-1.04502631808729	0.00967934859969721
STAD	PNPT1	-2.72869865637622	1.11940316855908e-05
KIRC	PNPT1	1.16005507166092	2.90348670181982e-08

Top

Expression Regulation

Translation factor expression regulation through miRNA binding

Cancer type	Gene	miRNA	TargetScan binding score (Context++ score percentile)	Coefficient	Pvalue
UCEC	PNPT1	hsa-miR-145-5p	70	0.364400305576776	0.0347909025005121

Translation factor expression regulation through methylation in the promoter of Translation factor

Cancer type

Gene

methyl group b

methyl group a

DEG pval

avg methyl in b

avg methyl in a

avg exp in b

avg exp in a

Translation factor expression regulation through methylation in the gene body of Translation factor (positive regulation)

Cancer type

Gene

methyl group b

methyl group a

DEG pval

avg methyl in b

avg methyl in a

avg exp in b

avg exp in a

Translation factor expression regulation through copy number variation of Translation factor

Cancer type	Gene	Coefficient	Pvalue
LIHC	PNPT1	0.03310716	0.037579673

Top

Associated Genes

Strongly correlated genes belong to cellular important gene groups with PNPT1 (coefficient>0.8, pval<0.05, node color based on FC between tumor and matched normal). Significantly associated important genes in the individual cancer types. * Cell metabolism gene: cell metabolism genes from REACTOME (black edge), IUPHAR: drug target genes from IUPHAR (blue edge), Kinase: human kinase genes (brown edge), CGC: cancer gene census genes (orange edge), TSG: tumor suppresor genes (purple edge), Epifactor: epigenetic factors (light blue edge), TF: transcription factors (green)

Cancer type	Gene group	Translation factor	Correlated gene	Coefficient	Pvalue
COAD	Cell metabolism gene	PNPT1	HSPD1	0.841301512	2.29E-89
COAD	TSG	PNPT1	HSPD1	0.841301512	2.29E-89
KICH	Cell metabolism gene	PNPT1	PSMD14	0.81075139	2.08E-22
KICH	Cell metabolism gene	PNPT1	PIGF	0.81332359	1.20E-22
KICH	CGC	PNPT1	MSH2	0.804596148	7.47E-22
KICH	Epifactor	PNPT1	ATF2	0.80540742	6.33E-22
KICH	Epifactor	PNPT1	SMEK2	0.813111047	1.26E-22
KICH	Epifactor	PNPT1	HAT1	0.825373326	8.15E-24
KICH	IUPHAR	PNPT1	PSMD14	0.81075139	2.08E-22
KICH	IUPHAR	PNPT1	HAT1	0.825373326	8.15E-24
KICH	TF	PNPT1	ATF2	0.80540742	6.33E-22
KICH	TF	PNPT1	CEBPZ	0.832966004	1.34E-24
KICH	TSG	PNPT1	MSH2	0.804596148	7.47E-22
SKCM	Cell metabolism gene	PNPT1	XPO1	0.834197234	4.37E-124
SKCM	CGC	PNPT1	XPO1	0.834197234	4.37E-124
SKCM	IUPHAR	PNPT1	XPO1	0.834197234	4.37E-124
SKCM	TF	PNPT1	CEBPZ	0.817357669	4.15E-115
THYM	CGC	PNPT1	PALB2	0.81578239	2.58E-30
THYM	TSG	PNPT1	PALB2	0.81578239	2.58E-30
UCS	CGC	PNPT1	PALB2	0.81578239	2.58E-30
UCS	TSG	PNPT1	PALB2	0.81578239	2.58E-30
UVM	Cell metabolism gene	PNPT1	FUT8	0.800300489	5.27E-19
UVM	Cell metabolism gene	PNPT1	NUP35	0.800346314	5.22E-19
UVM	Cell metabolism gene	PNPT1	TGS1	0.801520439	4.25E-19
UVM	Cell metabolism gene	PNPT1	TRDMT1	0.802355697	3.67E-19
UVM	Cell metabolism gene	PNPT1	GLS	0.803451	3.02E-19
UVM	Cell metabolism gene	PNPT1	NANP	0.803795034	2.84E-19
UVM	Cell metabolism gene	PNPT1	ME2	0.803891829	2.79E-19
UVM	Cell metabolism gene	PNPT1	SMG1	0.805106898	2.25E-19
UVM	Cell metabolism gene	PNPT1	PIK3C2A	0.806182851	1.85E-19
UVM	Cell metabolism gene	PNPT1	PHAX	0.806862918	1.64E-19
UVM	Cell metabolism gene	PNPT1	SEC23A	0.807923709	1.35E-19
UVM	Cell metabolism gene	PNPT1	DLAT	0.807925395	1.35E-19
UVM	Cell metabolism gene	PNPT1	PPP1CB	0.809600039	9.91E-20
UVM	Cell metabolism gene	PNPT1	CNOT2	0.8096739	9.78E-20
UVM	Cell metabolism gene	PNPT1	SDHD	0.810542344	8.33E-20
UVM	Cell metabolism gene	PNPT1	GPAM	0.811252116	7.30E-20
UVM	Cell metabolism gene	PNPT1	PSME4	0.811883177	6.49E-20
UVM	Cell metabolism gene	PNPT1	POLR2B	0.813794533	4.53E-20
UVM	Cell metabolism gene	PNPT1	ENOPH1	0.814853245	3.70E-20
UVM	Cell metabolism gene	PNPT1	GLUD2	0.815349029	3.37E-20
UVM	Cell metabolism gene	PNPT1	CNOT8	0.815583752	3.22E-20
UVM	Cell metabolism gene	PNPT1	GXYLT1	0.815917552	3.02E-20
UVM	Cell metabolism gene	PNPT1	CPOX	0.816552455	2.68E-20
UVM	Cell metabolism gene	PNPT1	ALG13	0.817097211	2.41E-20
UVM	Cell metabolism gene	PNPT1	MED4	0.817245316	2.34E-20
UVM	Cell metabolism gene	PNPT1	MCEE	0.817603836	2.18E-20
UVM	Cell metabolism gene	PNPT1	MED7	0.818579161	1.81E-20
UVM	Cell metabolism gene	PNPT1	GLUD1	0.818817892	1.73E-20
UVM	Cell metabolism gene	PNPT1	COL4A3BP	0.819071902	1.64E-20
UVM	Cell metabolism gene	PNPT1	SEH1L	0.821280686	1.06E-20
UVM	Cell metabolism gene	PNPT1	GCLC	0.821342399	1.05E-20
UVM	Cell metabolism gene	PNPT1	IDI1	0.8217478	9.70E-21
UVM	Cell metabolism gene	PNPT1	PIK3C3	0.823790059	6.45E-21
UVM	Cell metabolism gene	PNPT1	ACADSB	0.824836061	5.22E-21
UVM	Cell metabolism gene	PNPT1	BPNT1	0.828826659	2.30E-21
UVM	Cell metabolism gene	PNPT1	PIP5K1A	0.829034454	2.21E-21
UVM	Cell metabolism gene	PNPT1	PDHX	0.829833712	1.87E-21
UVM	Cell metabolism gene	PNPT1	DPM1	0.830527182	1.61E-21
UVM	Cell metabolism gene	PNPT1	MANEA	0.831622423	1.28E-21
UVM	Cell metabolism gene	PNPT1	NUPL2	0.831980809	1.19E-21
UVM	Cell metabolism gene	PNPT1	CCT2	0.833106566	9.35E-22
UVM	Cell metabolism gene	PNPT1	PLA2G12A	0.833249988	9.07E-22
UVM	Cell metabolism gene	PNPT1	CLOCK	0.833614328	8.39E-22
UVM	Cell metabolism gene	PNPT1	NUDT12	0.834299034	7.24E-22
UVM	Cell metabolism gene	PNPT1	L2HGDH	0.835654309	5.40E-22
UVM	Cell metabolism gene	PNPT1	CSGALNACT2	0.837421047	3.67E-22
UVM	Cell metabolism gene	PNPT1	MGAT2	0.838815618	2.70E-22
UVM	Cell metabolism gene	PNPT1	LYPLA1	0.838937235	2.63E-22
UVM	Cell metabolism gene	PNPT1	CDK8	0.840153643	2.00E-22
UVM	Cell metabolism gene	PNPT1	DCK	0.843606856	9.16E-23
UVM	Cell metabolism gene	PNPT1	PIKFYVE	0.845942365	5.34E-23
UVM	Cell metabolism gene	PNPT1	ACSL4	0.846877033	4.29E-23
UVM	Cell metabolism gene	PNPT1	SACM1L	0.847398331	3.79E-23
UVM	Cell metabolism gene	PNPT1	AASDHPPT	0.848010408	3.28E-23
UVM	Cell metabolism gene	PNPT1	ARFGEF2	0.850787979	1.69E-23
UVM	Cell metabolism gene	PNPT1	MTR	0.851009686	1.60E-23
UVM	Cell metabolism gene	PNPT1	GRPEL2	0.852264034	1.18E-23
UVM	Cell metabolism gene	PNPT1	PI4K2B	0.8524458	1.13E-23
UVM	Cell metabolism gene	PNPT1	GPD2	0.854869803	6.21E-24
UVM	Cell metabolism gene	PNPT1	RANBP2	0.856267397	4.38E-24
UVM	Cell metabolism gene	PNPT1	ALG10B	0.856614027	4.01E-24
UVM	Cell metabolism gene	PNPT1	UGGT2	0.857685319	3.06E-24
UVM	Cell metabolism gene	PNPT1	TNPO1	0.860511656	1.48E-24
UVM	Cell metabolism gene	PNPT1	PSMD14	0.861963314	1.01E-24
UVM	Cell metabolism gene	PNPT1	NUP107	0.86266134	8.43E-25
UVM	Cell metabolism gene	PNPT1	HMGCS1	0.863239318	7.24E-25
UVM	Cell metabolism gene	PNPT1	FBXL3	0.863851108	6.15E-25
UVM	Cell metabolism gene	PNPT1	MINPP1	0.864645913	4.97E-25
UVM	Cell metabolism gene	PNPT1	PNPLA8	0.866228169	3.24E-25
UVM	Cell metabolism gene	PNPT1	RPE	0.866816167	2.76E-25
UVM	Cell metabolism gene	PNPT1	NAMPT	0.870736082	9.31E-26
UVM	Cell metabolism gene	PNPT1	PPAT	0.872603622	5.48E-26
UVM	Cell metabolism gene	PNPT1	GNPDA2	0.874647901	3.03E-26
UVM	Cell metabolism gene	PNPT1	LCLAT1	0.875068525	2.68E-26
UVM	Cell metabolism gene	PNPT1	ETNK1	0.876062351	2.00E-26
UVM	Cell metabolism gene	PNPT1	MED17	0.8765687	1.73E-26
UVM	Cell metabolism gene	PNPT1	AGPS	0.877704945	1.23E-26
UVM	Cell metabolism gene	PNPT1	PSMC6	0.877716519	1.23E-26
UVM	Cell metabolism gene	PNPT1	NUPL1	0.883701916	1.95E-27
UVM	Cell metabolism gene	PNPT1	FAR1	0.884585244	1.47E-27
UVM	Cell metabolism gene	PNPT1	DIS3	0.894172951	6.03E-29
UVM	Cell metabolism gene	PNPT1	PRKAA1	0.897890634	1.61E-29
UVM	Cell metabolism gene	PNPT1	EDEM3	0.900155137	7.00E-30
UVM	Cell metabolism gene	PNPT1	NUP50	0.903206272	2.22E-30
UVM	Cell metabolism gene	PNPT1	MTMR6	0.905041363	1.09E-30
UVM	Cell metabolism gene	PNPT1	XPO1	0.933367677	1.88E-36
UVM	CGC	PNPT1	HNRNPA2B1	0.802034168	3.88E-19
UVM	CGC	PNPT1	TRIM24	0.807473562	1.46E-19
UVM	CGC	PNPT1	BCLAF1	0.809788715	9.57E-20
UVM	CGC	PNPT1	SDHD	0.810542344	8.33E-20
UVM	CGC	PNPT1	AFF4	0.810831473	7.89E-20
UVM	CGC	PNPT1	NBN	0.811624692	6.81E-20
UVM	CGC	PNPT1	ABI1	0.811816082	6.57E-20
UVM	CGC	PNPT1	HSP90AA1	0.812290597	6.01E-20
UVM	CGC	PNPT1	SS18L1	0.812677987	5.59E-20
UVM	CGC	PNPT1	N4BP2	0.813662812	4.64E-20
UVM	CGC	PNPT1	ERCC4	0.815718976	3.14E-20
UVM	CGC	PNPT1	RB1	0.815930145	3.02E-20
UVM	CGC	PNPT1	RGPD3	0.816089293	2.92E-20
UVM	CGC	PNPT1	NFE2L2	0.816123467	2.91E-20
UVM	CGC	PNPT1	ARID2	0.816606434	2.65E-20
UVM	CGC	PNPT1	DDX10	0.820567286	1.22E-20
UVM	CGC	PNPT1	PTPN11	0.820748692	1.18E-20
UVM	CGC	PNPT1	ATF1	0.821137303	1.09E-20
UVM	CGC	PNPT1	TOP1	0.823767288	6.48E-21
UVM	CGC	PNPT1	PALB2	0.824155966	5.99E-21
UVM	CGC	PNPT1	ARHGAP5	0.825101818	4.95E-21
UVM	CGC	PNPT1	USP8	0.825364853	4.69E-21
UVM	CGC	PNPT1	RABEP1	0.8261998	3.96E-21
UVM	CGC	PNPT1	PHF6	0.826462895	3.75E-21
UVM	CGC	PNPT1	ITGAV	0.827068988	3.31E-21
UVM	CGC	PNPT1	SMAD4	0.8287961	2.32E-21
UVM	CGC	PNPT1	DICER1	0.829229084	2.12E-21
UVM	CGC	PNPT1	BIRC6	0.833185247	9.20E-22
UVM	CGC	PNPT1	PWWP2A	0.836637842	4.36E-22
UVM	CGC	PNPT1	STAG2	0.837258678	3.81E-22
UVM	CGC	PNPT1	EZH2	0.839628384	2.25E-22
UVM	CGC	PNPT1	RAD17	0.854531622	6.76E-24
UVM	CGC	PNPT1	KTN1	0.854674609	6.52E-24
UVM	CGC	PNPT1	RANBP2	0.856267397	4.38E-24
UVM	CGC	PNPT1	MSH2	0.858247902	2.65E-24
UVM	CGC	PNPT1	BRCA2	0.862820258	8.09E-25
UVM	CGC	PNPT1	EML4	0.863445629	6.85E-25
UVM	CGC	PNPT1	DDX5	0.864942827	4.59E-25
UVM	CGC	PNPT1	ZMYM2	0.865421548	4.03E-25
UVM	CGC	PNPT1	KRAS	0.867894455	2.06E-25
UVM	CGC	PNPT1	KIF5B	0.869498554	1.32E-25
UVM	CGC	PNPT1	BMPR1A	0.871080605	8.45E-26
UVM	CGC	PNPT1	ETNK1	0.876062351	2.00E-26
UVM	CGC	PNPT1	CUL3	0.881373895	4.03E-27
UVM	CGC	PNPT1	ATM	0.887196034	6.35E-28
UVM	CGC	PNPT1	CREB1	0.889082298	3.41E-28
UVM	CGC	PNPT1	POT1	0.891574316	1.48E-28
UVM	CGC	PNPT1	BAZ1A	0.89321398	8.41E-29
UVM	CGC	PNPT1	SF3B1	0.896021054	3.14E-29
UVM	CGC	PNPT1	FBXO11	0.901317095	4.54E-30
UVM	CGC	PNPT1	CDC73	0.90770177	3.78E-31
UVM	CGC	PNPT1	SUZ12	0.909865726	1.56E-31
UVM	CGC	PNPT1	PMS1	0.92875591	2.34E-35
UVM	CGC	PNPT1	XPO1	0.933367677	1.88E-36
UVM	Epifactor	PNPT1	PHIP	0.800053411	5.50E-19
UVM	Epifactor	PNPT1	RAD54B	0.800593011	5.00E-19
UVM	Epifactor	PNPT1	TRIM24	0.807473562	1.46E-19
UVM	Epifactor	PNPT1	DNTTIP2	0.809848428	9.47E-20
UVM	Epifactor	PNPT1	SMARCAD1	0.810836045	7.88E-20
UVM	Epifactor	PNPT1	NBN	0.811624692	6.81E-20
UVM	Epifactor	PNPT1	SS18L1	0.812677987	5.59E-20
UVM	Epifactor	PNPT1	BRMS1L	0.815263735	3.43E-20
UVM	Epifactor	PNPT1	RB1	0.815930145	3.02E-20
UVM	Epifactor	PNPT1	ARID2	0.816606434	2.65E-20
UVM	Epifactor	PNPT1	CHUK	0.817311729	2.31E-20
UVM	Epifactor	PNPT1	EPC1	0.819367013	1.55E-20
UVM	Epifactor	PNPT1	SMARCA5	0.823921242	6.28E-21
UVM	Epifactor	PNPT1	ANP32E	0.826240268	3.92E-21
UVM	Epifactor	PNPT1	TADA1	0.826380072	3.81E-21
UVM	Epifactor	PNPT1	ARID4B	0.82719051	3.23E-21
UVM	Epifactor	PNPT1	HCFC2	0.827364624	3.12E-21
UVM	Epifactor	PNPT1	TAF2	0.827512826	3.02E-21
UVM	Epifactor	PNPT1	MBTD1	0.830503104	1.62E-21
UVM	Epifactor	PNPT1	SIRT1	0.831053522	1.45E-21
UVM	Epifactor	PNPT1	CBX3	0.831233302	1.39E-21
UVM	Epifactor	PNPT1	SP100	0.831665718	1.27E-21
UVM	Epifactor	PNPT1	CLOCK	0.833614328	8.39E-22
UVM	Epifactor	PNPT1	EID1	0.834190147	7.41E-22
UVM	Epifactor	PNPT1	BAZ2B	0.834248083	7.32E-22
UVM	Epifactor	PNPT1	BRCC3	0.838388673	2.97E-22
UVM	Epifactor	PNPT1	SUPT7L	0.839226814	2.46E-22
UVM	Epifactor	PNPT1	EZH2	0.839628384	2.25E-22
UVM	Epifactor	PNPT1	CHD1	0.839810864	2.16E-22
UVM	Epifactor	PNPT1	RMI1	0.841407982	1.51E-22
UVM	Epifactor	PNPT1	NIPBL	0.841531586	1.47E-22
UVM	Epifactor	PNPT1	CTBP2	0.842250322	1.25E-22
UVM	Epifactor	PNPT1	PARG	0.84282422	1.10E-22
UVM	Epifactor	PNPT1	RCOR3	0.842967013	1.06E-22
UVM	Epifactor	PNPT1	UHRF2	0.843105842	1.03E-22
UVM	Epifactor	PNPT1	MASTL	0.845170146	6.39E-23
UVM	Epifactor	PNPT1	OGT	0.84605865	5.19E-23
UVM	Epifactor	PNPT1	PHF20L1	0.849363251	2.38E-23
UVM	Epifactor	PNPT1	ARID4A	0.850737128	1.71E-23
UVM	Epifactor	PNPT1	ACTR6	0.8511449	1.55E-23
UVM	Epifactor	PNPT1	YY1	0.85324584	9.29E-24
UVM	Epifactor	PNPT1	INO80D	0.854304951	7.15E-24
UVM	Epifactor	PNPT1	BRWD1	0.858670173	2.38E-24
UVM	Epifactor	PNPT1	SMEK1	0.858787369	2.31E-24
UVM	Epifactor	PNPT1	JMJD1C	0.859053505	2.16E-24
UVM	Epifactor	PNPT1	CHD9	0.859563014	1.89E-24
UVM	Epifactor	PNPT1	TAF7	0.860487176	1.49E-24
UVM	Epifactor	PNPT1	CDK17	0.862307818	9.26E-25
UVM	Epifactor	PNPT1	BRCA2	0.862820258	8.09E-25
UVM	Epifactor	PNPT1	ZMYM2	0.865421548	4.03E-25
UVM	Epifactor	PNPT1	RLIM	0.866222083	3.25E-25
UVM	Epifactor	PNPT1	ZRANB3	0.867805256	2.11E-25
UVM	Epifactor	PNPT1	AEBP2	0.868529131	1.73E-25
UVM	Epifactor	PNPT1	TDG	0.868746883	1.62E-25
UVM	Epifactor	PNPT1	ATF2	0.871596406	7.30E-26
UVM	Epifactor	PNPT1	HAT1	0.875377181	2.45E-26
UVM	Epifactor	PNPT1	FAM175B	0.876129078	1.96E-26
UVM	Epifactor	PNPT1	HMGB1	0.878602194	9.40E-27
UVM	Epifactor	PNPT1	USP15	0.880612579	5.10E-27
UVM	Epifactor	PNPT1	CUL3	0.881373895	4.03E-27
UVM	Epifactor	PNPT1	EPC2	0.882308435	3.02E-27
UVM	Epifactor	PNPT1	CUL5	0.882810793	2.58E-27
UVM	Epifactor	PNPT1	ATM	0.887196034	6.35E-28
UVM	Epifactor	PNPT1	ATAD2B	0.888445255	4.21E-28
UVM	Epifactor	PNPT1	YEATS4	0.888907451	3.62E-28
UVM	Epifactor	PNPT1	NSL1	0.889917496	2.58E-28
UVM	Epifactor	PNPT1	CUL2	0.890841602	1.89E-28
UVM	Epifactor	PNPT1	BAZ1A	0.89321398	8.41E-29
UVM	Epifactor	PNPT1	TLK1	0.894127126	6.13E-29
UVM	Epifactor	PNPT1	SF3B1	0.896021054	3.14E-29
UVM	Epifactor	PNPT1	PRKAA1	0.897890634	1.61E-29
UVM	Epifactor	PNPT1	PCGF6	0.897989696	1.55E-29
UVM	Epifactor	PNPT1	UCHL5	0.902942237	2.45E-30
UVM	Epifactor	PNPT1	CDC73	0.90770177	3.78E-31
UVM	Epifactor	PNPT1	SUZ12	0.909865726	1.56E-31
UVM	Epifactor	PNPT1	SMEK2	0.924661575	1.91E-34
UVM	IUPHAR	PNPT1	PHIP	0.800053411	5.50E-19
UVM	IUPHAR	PNPT1	SCYL2	0.800111605	5.44E-19
UVM	IUPHAR	PNPT1	MFN1	0.802509142	3.57E-19
UVM	IUPHAR	PNPT1	SLC35F5	0.803039167	3.25E-19
UVM	IUPHAR	PNPT1	ATP6V1C1	0.803188202	3.16E-19
UVM	IUPHAR	PNPT1	GLS	0.803451	3.02E-19
UVM	IUPHAR	PNPT1	SMG1	0.805106898	2.25E-19
UVM	IUPHAR	PNPT1	EGLN1	0.805322519	2.16E-19
UVM	IUPHAR	PNPT1	PIK3C2A	0.806182851	1.85E-19
UVM	IUPHAR	PNPT1	NR3C1	0.806737685	1.67E-19
UVM	IUPHAR	PNPT1	SLC26A2	0.8072207	1.53E-19
UVM	IUPHAR	PNPT1	TRIM24	0.807473562	1.46E-19
UVM	IUPHAR	PNPT1	NEK1	0.812288635	6.01E-20
UVM	IUPHAR	PNPT1	HSP90AA1	0.812290597	6.01E-20
UVM	IUPHAR	PNPT1	TRPC1	0.812539489	5.74E-20
UVM	IUPHAR	PNPT1	ATP11C	0.813091027	5.17E-20
UVM	IUPHAR	PNPT1	IRAK4	0.815903442	3.03E-20
UVM	IUPHAR	PNPT1	SLK	0.815903737	3.03E-20
UVM	IUPHAR	PNPT1	NFE2L2	0.816123467	2.91E-20
UVM	IUPHAR	PNPT1	CYP20A1	0.816760728	2.57E-20
UVM	IUPHAR	PNPT1	CHUK	0.817311729	2.31E-20
UVM	IUPHAR	PNPT1	DYRK1A	0.820447582	1.25E-20
UVM	IUPHAR	PNPT1	IDI1	0.8217478	9.70E-21
UVM	IUPHAR	PNPT1	CYP2R1	0.822857976	7.77E-21
UVM	IUPHAR	PNPT1	TOP1	0.823767288	6.48E-21
UVM	IUPHAR	PNPT1	PIK3C3	0.823790059	6.45E-21
UVM	IUPHAR	PNPT1	SLC30A9	0.825043147	5.01E-21
UVM	IUPHAR	PNPT1	SLC37A3	0.826796669	3.50E-21
UVM	IUPHAR	PNPT1	ITGAV	0.827068988	3.31E-21
UVM	IUPHAR	PNPT1	MAGT1	0.827417661	3.08E-21
UVM	IUPHAR	PNPT1	PREPL	0.827473328	3.05E-21
UVM	IUPHAR	PNPT1	PIP5K1A	0.829034454	2.21E-21
UVM	IUPHAR	PNPT1	PRPF4B	0.829608869	1.96E-21
UVM	IUPHAR	PNPT1	STK17A	0.830588587	1.59E-21
UVM	IUPHAR	PNPT1	SIRT1	0.831053522	1.45E-21
UVM	IUPHAR	PNPT1	CSNK1A1	0.831220672	1.40E-21
UVM	IUPHAR	PNPT1	SP100	0.831665718	1.27E-21
UVM	IUPHAR	PNPT1	BIRC6	0.833185247	9.20E-22
UVM	IUPHAR	PNPT1	PLA2G12A	0.833249988	9.07E-22
UVM	IUPHAR	PNPT1	CLOCK	0.833614328	8.39E-22
UVM	IUPHAR	PNPT1	PLK4	0.833643766	8.34E-22
UVM	IUPHAR	PNPT1	BAZ2B	0.834248083	7.32E-22
UVM	IUPHAR	PNPT1	STK38L	0.836561203	4.43E-22
UVM	IUPHAR	PNPT1	SLC4A7	0.83691189	4.11E-22
UVM	IUPHAR	PNPT1	MAPK6	0.837488403	3.62E-22
UVM	IUPHAR	PNPT1	EZH2	0.839628384	2.25E-22
UVM	IUPHAR	PNPT1	CDK8	0.840153643	2.00E-22
UVM	IUPHAR	PNPT1	SLC25A46	0.843305704	9.81E-23
UVM	IUPHAR	PNPT1	MASTL	0.845170146	6.39E-23
UVM	IUPHAR	PNPT1	PIKFYVE	0.845942365	5.34E-23
UVM	IUPHAR	PNPT1	BIRC2	0.847097168	4.07E-23
UVM	IUPHAR	PNPT1	RPS6KC1	0.847901564	3.37E-23
UVM	IUPHAR	PNPT1	MTR	0.851009686	1.60E-23
UVM	IUPHAR	PNPT1	ABCB10	0.851241356	1.51E-23
UVM	IUPHAR	PNPT1	PI4K2B	0.8524458	1.13E-23
UVM	IUPHAR	PNPT1	VRK2	0.856356868	4.28E-24
UVM	IUPHAR	PNPT1	NR2C1	0.856864536	3.77E-24
UVM	IUPHAR	PNPT1	BRWD1	0.858670173	2.38E-24
UVM	IUPHAR	PNPT1	XIAP	0.858835572	2.28E-24
UVM	IUPHAR	PNPT1	JMJD1C	0.859053505	2.16E-24
UVM	IUPHAR	PNPT1	NAPEPLD	0.860807268	1.37E-24
UVM	IUPHAR	PNPT1	MAP3K2	0.861443563	1.16E-24
UVM	IUPHAR	PNPT1	PSMD14	0.861963314	1.01E-24
UVM	IUPHAR	PNPT1	TRPM7	0.862036729	9.94E-25
UVM	IUPHAR	PNPT1	CDK17	0.862307818	9.26E-25
UVM	IUPHAR	PNPT1	USP14	0.862981684	7.75E-25
UVM	IUPHAR	PNPT1	NEK7	0.863108138	7.49E-25
UVM	IUPHAR	PNPT1	BMPR2	0.863230236	7.25E-25
UVM	IUPHAR	PNPT1	HMGCS1	0.863239318	7.24E-25
UVM	IUPHAR	PNPT1	SLC39A10	0.864419559	5.28E-25
UVM	IUPHAR	PNPT1	RIOK3	0.866542832	2.98E-25
UVM	IUPHAR	PNPT1	KRAS	0.867894455	2.06E-25
UVM	IUPHAR	PNPT1	ATP6V0A2	0.869981662	1.15E-25
UVM	IUPHAR	PNPT1	BMPR1A	0.871080605	8.45E-26
UVM	IUPHAR	PNPT1	TNKS2	0.871678004	7.13E-26
UVM	IUPHAR	PNPT1	PPAT	0.872603622	5.48E-26
UVM	IUPHAR	PNPT1	ADAM17	0.874688586	3.00E-26
UVM	IUPHAR	PNPT1	TBK1	0.874799703	2.90E-26
UVM	IUPHAR	PNPT1	CSNK1G3	0.874927969	2.80E-26
UVM	IUPHAR	PNPT1	HAT1	0.875377181	2.45E-26
UVM	IUPHAR	PNPT1	MAP4K3	0.875911284	2.10E-26
UVM	IUPHAR	PNPT1	ATM	0.887196034	6.35E-28
UVM	IUPHAR	PNPT1	ATAD2B	0.888445255	4.21E-28
UVM	IUPHAR	PNPT1	BAZ1A	0.89321398	8.41E-29
UVM	IUPHAR	PNPT1	TLK1	0.894127126	6.13E-29
UVM	IUPHAR	PNPT1	PRKAA1	0.897890634	1.61E-29
UVM	IUPHAR	PNPT1	FBXO11	0.901317095	4.54E-30
UVM	IUPHAR	PNPT1	PRMT3	0.902258367	3.18E-30
UVM	IUPHAR	PNPT1	XPO1	0.933367677	1.88E-36
UVM	Kinase	PNPT1	SCYL2	0.800111605	5.44E-19
UVM	Kinase	PNPT1	SMG1	0.805106898	2.25E-19
UVM	Kinase	PNPT1	TRIM24	0.807473562	1.46E-19
UVM	Kinase	PNPT1	NEK1	0.812288635	6.01E-20
UVM	Kinase	PNPT1	PAN3	0.814507308	3.96E-20
UVM	Kinase	PNPT1	IRAK4	0.815903442	3.03E-20
UVM	Kinase	PNPT1	SLK	0.815903737	3.03E-20
UVM	Kinase	PNPT1	CHUK	0.817311729	2.31E-20
UVM	Kinase	PNPT1	COL4A3BP	0.819071902	1.64E-20
UVM	Kinase	PNPT1	DYRK1A	0.820447582	1.25E-20
UVM	Kinase	PNPT1	PRPF4B	0.829608869	1.96E-21
UVM	Kinase	PNPT1	STK17A	0.830588587	1.59E-21
UVM	Kinase	PNPT1	CSNK1A1	0.831220672	1.40E-21
UVM	Kinase	PNPT1	PLK4	0.833643766	8.34E-22
UVM	Kinase	PNPT1	STK38L	0.836561203	4.43E-22
UVM	Kinase	PNPT1	MAPK6	0.837488403	3.62E-22
UVM	Kinase	PNPT1	CDK8	0.840153643	2.00E-22
UVM	Kinase	PNPT1	MASTL	0.845170146	6.39E-23
UVM	Kinase	PNPT1	RPS6KC1	0.847901564	3.37E-23
UVM	Kinase	PNPT1	VRK2	0.856356868	4.28E-24
UVM	Kinase	PNPT1	MAP3K2	0.861443563	1.16E-24
UVM	Kinase	PNPT1	TRPM7	0.862036729	9.94E-25
UVM	Kinase	PNPT1	CDK17	0.862307818	9.26E-25
UVM	Kinase	PNPT1	NEK7	0.863108138	7.49E-25
UVM	Kinase	PNPT1	BMPR2	0.863230236	7.25E-25
UVM	Kinase	PNPT1	RIOK3	0.866542832	2.98E-25
UVM	Kinase	PNPT1	BMPR1A	0.871080605	8.45E-26
UVM	Kinase	PNPT1	TBK1	0.874799703	2.90E-26
UVM	Kinase	PNPT1	CSNK1G3	0.874927969	2.80E-26
UVM	Kinase	PNPT1	MAP4K3	0.875911284	2.10E-26
UVM	Kinase	PNPT1	ATM	0.887196034	6.35E-28
UVM	Kinase	PNPT1	BAZ1A	0.89321398	8.41E-29
UVM	Kinase	PNPT1	TLK1	0.894127126	6.13E-29
UVM	Kinase	PNPT1	PRKAA1	0.897890634	1.61E-29
UVM	TF	PNPT1	ZNF606	0.801747654	4.08E-19
UVM	TF	PNPT1	ZBTB11	0.801951339	3.94E-19
UVM	TF	PNPT1	ZNF160	0.802653492	3.48E-19
UVM	TF	PNPT1	ZNF572	0.802963588	3.29E-19
UVM	TF	PNPT1	ZNF480	0.803191534	3.16E-19
UVM	TF	PNPT1	ZNF625	0.803882689	2.80E-19
UVM	TF	PNPT1	TERF1	0.803940357	2.77E-19
UVM	TF	PNPT1	ZNF143	0.805582146	2.06E-19
UVM	TF	PNPT1	NR3C1	0.806737685	1.67E-19
UVM	TF	PNPT1	ZNF83	0.808099951	1.31E-19
UVM	TF	PNPT1	ZNF230	0.808328209	1.25E-19
UVM	TF	PNPT1	MYNN	0.808640982	1.18E-19
UVM	TF	PNPT1	ZNF678	0.808823997	1.14E-19
UVM	TF	PNPT1	ZNF326	0.809609551	9.89E-20
UVM	TF	PNPT1	ZNF557	0.809701306	9.73E-20
UVM	TF	PNPT1	ZNF420	0.80995716	9.28E-20
UVM	TF	PNPT1	ZC3H8	0.810242252	8.80E-20
UVM	TF	PNPT1	ZKSCAN5	0.810835704	7.88E-20
UVM	TF	PNPT1	ZFX	0.811178032	7.40E-20
UVM	TF	PNPT1	ZNF799	0.811359892	7.15E-20
UVM	TF	PNPT1	SP4	0.81147856	7.00E-20
UVM	TF	PNPT1	ZNF714	0.811897455	6.47E-20
UVM	TF	PNPT1	ZNF280D	0.812418705	5.87E-20
UVM	TF	PNPT1	ZNF141	0.81302609	5.23E-20
UVM	TF	PNPT1	ZNF148	0.813626264	4.67E-20
UVM	TF	PNPT1	ZNF23	0.814380609	4.05E-20
UVM	TF	PNPT1	ZFP14	0.814531389	3.94E-20
UVM	TF	PNPT1	ZNF354B	0.814682308	3.83E-20
UVM	TF	PNPT1	NFE2L2	0.816123467	2.91E-20
UVM	TF	PNPT1	ARID2	0.816606434	2.65E-20
UVM	TF	PNPT1	ZNF565	0.816961511	2.47E-20
UVM	TF	PNPT1	ZNF320	0.817188906	2.37E-20
UVM	TF	PNPT1	ZNF461	0.817602089	2.19E-20
UVM	TF	PNPT1	ELF2	0.818306665	1.91E-20
UVM	TF	PNPT1	ZNF75D	0.818793323	1.73E-20
UVM	TF	PNPT1	ZNF107	0.818899547	1.70E-20
UVM	TF	PNPT1	ZNF397	0.819061279	1.65E-20
UVM	TF	PNPT1	ZNF680	0.82044364	1.25E-20
UVM	TF	PNPT1	ATF1	0.821137303	1.09E-20
UVM	TF	PNPT1	ADNP2	0.821159781	1.09E-20
UVM	TF	PNPT1	ZNF443	0.822395384	8.52E-21
UVM	TF	PNPT1	ZNF260	0.822488443	8.37E-21
UVM	TF	PNPT1	ZNF611	0.822611297	8.16E-21
UVM	TF	PNPT1	ZNF101	0.822746095	7.95E-21
UVM	TF	PNPT1	ZNF569	0.823267561	7.16E-21
UVM	TF	PNPT1	ZNF41	0.823292675	7.12E-21
UVM	TF	PNPT1	ZNF468	0.823679865	6.59E-21
UVM	TF	PNPT1	ZNF44	0.82379366	6.44E-21
UVM	TF	PNPT1	ZNF223	0.825396024	4.66E-21
UVM	TF	PNPT1	ZBED5	0.82595283	4.16E-21
UVM	TF	PNPT1	THAP9	0.826024468	4.10E-21
UVM	TF	PNPT1	GABPA	0.826144672	4.00E-21
UVM	TF	PNPT1	ZNF17	0.826768728	3.52E-21
UVM	TF	PNPT1	ZNF721	0.826909177	3.42E-21
UVM	TF	PNPT1	ZNF37A	0.827985536	2.74E-21
UVM	TF	PNPT1	SMAD4	0.8287961	2.32E-21
UVM	TF	PNPT1	ZNF780B	0.829179215	2.14E-21
UVM	TF	PNPT1	HDX	0.829207064	2.13E-21
UVM	TF	PNPT1	ZNF268	0.829627252	1.95E-21
UVM	TF	PNPT1	ZNF555	0.83005293	1.78E-21
UVM	TF	PNPT1	ZNF14	0.830565796	1.60E-21
UVM	TF	PNPT1	ZNF226	0.83057653	1.60E-21
UVM	TF	PNPT1	ZNF100	0.830894357	1.49E-21
UVM	TF	PNPT1	ZNF558	0.830900758	1.49E-21
UVM	TF	PNPT1	ZNF484	0.831193486	1.40E-21
UVM	TF	PNPT1	ZNF658	0.831537266	1.31E-21
UVM	TF	PNPT1	SP100	0.831665718	1.27E-21
UVM	TF	PNPT1	ZNF546	0.831919814	1.20E-21
UVM	TF	PNPT1	ELK3	0.832069636	1.17E-21
UVM	TF	PNPT1	ZNF248	0.833371657	8.84E-22
UVM	TF	PNPT1	CLOCK	0.833614328	8.39E-22
UVM	TF	PNPT1	TMF1	0.834209023	7.38E-22
UVM	TF	PNPT1	BAZ2B	0.834248083	7.32E-22
UVM	TF	PNPT1	ZNF281	0.834414485	7.06E-22
UVM	TF	PNPT1	ZNF761	0.834827801	6.46E-22
UVM	TF	PNPT1	ZNF845	0.835067557	6.14E-22
UVM	TF	PNPT1	ZNF225	0.835167471	6.00E-22
UVM	TF	PNPT1	ZNF33A	0.835439979	5.66E-22
UVM	TF	PNPT1	ZNF347	0.835859131	5.17E-22
UVM	TF	PNPT1	ZNF302	0.835993302	5.02E-22
UVM	TF	PNPT1	ZNF24	0.837200671	3.85E-22
UVM	TF	PNPT1	ZNF81	0.837304109	3.77E-22
UVM	TF	PNPT1	ZNF84	0.837310097	3.76E-22
UVM	TF	PNPT1	ZNF440	0.838954483	2.62E-22
UVM	TF	PNPT1	PRDM10	0.839433893	2.35E-22
UVM	TF	PNPT1	ZBTB6	0.840514138	1.85E-22
UVM	TF	PNPT1	ZNF566	0.842023566	1.31E-22
UVM	TF	PNPT1	ZNF780A	0.842236495	1.25E-22
UVM	TF	PNPT1	ZNF25	0.842322903	1.23E-22
UVM	TF	PNPT1	ZNF567	0.843533519	9.31E-23
UVM	TF	PNPT1	ZNF10	0.843902301	8.56E-23
UVM	TF	PNPT1	ZNF254	0.844489077	7.47E-23
UVM	TF	PNPT1	ZNF45	0.845079891	6.52E-23
UVM	TF	PNPT1	ZBTB41	0.845489153	5.93E-23
UVM	TF	PNPT1	THAP6	0.847401762	3.79E-23
UVM	TF	PNPT1	ZNF146	0.847718787	3.52E-23
UVM	TF	PNPT1	ZNF432	0.847748576	3.49E-23
UVM	TF	PNPT1	LIN54	0.84792514	3.35E-23
UVM	TF	PNPT1	JRKL	0.847989298	3.30E-23
UVM	TF	PNPT1	ZNF451	0.848604937	2.85E-23
UVM	TF	PNPT1	ZNF585B	0.849561432	2.27E-23
UVM	TF	PNPT1	ZNF267	0.849879594	2.10E-23
UVM	TF	PNPT1	ZNF12	0.850000933	2.04E-23
UVM	TF	PNPT1	ZNF383	0.850053535	2.02E-23
UVM	TF	PNPT1	ZNF222	0.850525725	1.80E-23
UVM	TF	PNPT1	YY1	0.85324584	9.29E-24
UVM	TF	PNPT1	ZNF708	0.853883947	7.93E-24
UVM	TF	PNPT1	ZNF182	0.854165275	7.40E-24
UVM	TF	PNPT1	ZNF92	0.855150904	5.79E-24
UVM	TF	PNPT1	RBAK	0.855517618	5.29E-24
UVM	TF	PNPT1	ZNF624	0.855566831	5.22E-24
UVM	TF	PNPT1	ZNF791	0.856382068	4.26E-24
UVM	TF	PNPT1	NR2C1	0.856864536	3.77E-24
UVM	TF	PNPT1	ZNF140	0.858651846	2.39E-24
UVM	TF	PNPT1	NFXL1	0.859139997	2.11E-24
UVM	TF	PNPT1	ZNF431	0.859283838	2.03E-24
UVM	TF	PNPT1	ZNF674	0.860042321	1.67E-24
UVM	TF	PNPT1	IKZF5	0.860535746	1.47E-24
UVM	TF	PNPT1	AHCTF1	0.86062211	1.44E-24
UVM	TF	PNPT1	ZNF180	0.860797967	1.37E-24
UVM	TF	PNPT1	GPBP1	0.861518514	1.14E-24
UVM	TF	PNPT1	ZNF527	0.861594975	1.12E-24
UVM	TF	PNPT1	MYBL1	0.861661544	1.10E-24
UVM	TF	PNPT1	DMTF1	0.861926349	1.02E-24
UVM	TF	PNPT1	ZNF234	0.862317418	9.23E-25
UVM	TF	PNPT1	ZNF510	0.864149666	5.68E-25
UVM	TF	PNPT1	ZNF136	0.864189744	5.62E-25
UVM	TF	PNPT1	TOPORS	0.864796198	4.77E-25
UVM	TF	PNPT1	PURB	0.864863758	4.69E-25
UVM	TF	PNPT1	MEF2A	0.865762067	3.68E-25
UVM	TF	PNPT1	ZNF28	0.865940185	3.51E-25
UVM	TF	PNPT1	AEBP2	0.868529131	1.73E-25
UVM	TF	PNPT1	ELF1	0.869101693	1.47E-25
UVM	TF	PNPT1	ZNF518A	0.870279628	1.06E-25
UVM	TF	PNPT1	ATF2	0.871596406	7.30E-26
UVM	TF	PNPT1	ZNF131	0.871695477	7.10E-26
UVM	TF	PNPT1	CREBZF	0.872108958	6.31E-26
UVM	TF	PNPT1	ZNF138	0.873021198	4.86E-26
UVM	TF	PNPT1	SMAD5	0.873573634	4.14E-26
UVM	TF	PNPT1	ZNF800	0.875148085	2.62E-26
UVM	TF	PNPT1	ZNF430	0.876042709	2.02E-26
UVM	TF	PNPT1	ZNF700	0.876368028	1.83E-26
UVM	TF	PNPT1	ZNF43	0.876463591	1.78E-26
UVM	TF	PNPT1	ZNF195	0.877109074	1.47E-26
UVM	TF	PNPT1	ZNF701	0.878500165	9.69E-27
UVM	TF	PNPT1	ZNF449	0.878732258	9.03E-27
UVM	TF	PNPT1	ZNF26	0.879733429	6.67E-27
UVM	TF	PNPT1	THAP5	0.879750152	6.63E-27
UVM	TF	PNPT1	ZBTB1	0.879821471	6.49E-27
UVM	TF	PNPT1	FOXN2	0.882178685	3.14E-27
UVM	TF	PNPT1	BACH1	0.884005577	1.77E-27
UVM	TF	PNPT1	ZNF181	0.885537421	1.09E-27
UVM	TF	PNPT1	SP3	0.888164249	4.62E-28
UVM	TF	PNPT1	CREB1	0.889082298	3.41E-28
UVM	TF	PNPT1	PCGF6	0.897989696	1.55E-29
UVM	TF	PNPT1	ZNF441	0.898531983	1.27E-29
UVM	TF	PNPT1	ZNF675	0.900470423	6.23E-30
UVM	TF	PNPT1	PRMT3	0.902258367	3.18E-30
UVM	TF	PNPT1	CEBPZ	0.914631803	2.06E-32
UVM	TSG	PNPT1	EGLN1	0.805322519	2.16E-19
UVM	TSG	PNPT1	TRIM24	0.807473562	1.46E-19
UVM	TSG	PNPT1	SDHD	0.810542344	8.33E-20
UVM	TSG	PNPT1	NBN	0.811624692	6.81E-20
UVM	TSG	PNPT1	RB1	0.815930145	3.02E-20
UVM	TSG	PNPT1	IFT88	0.816025358	2.96E-20
UVM	TSG	PNPT1	ARID2	0.816606434	2.65E-20
UVM	TSG	PNPT1	CHUK	0.817311729	2.31E-20
UVM	TSG	PNPT1	PTPN12	0.817444848	2.25E-20
UVM	TSG	PNPT1	PTPN11	0.820748692	1.18E-20
UVM	TSG	PNPT1	PALB2	0.824155966	5.99E-21
UVM	TSG	PNPT1	PHF6	0.826462895	3.75E-21
UVM	TSG	PNPT1	ITGAV	0.827068988	3.31E-21
UVM	TSG	PNPT1	SMAD4	0.8287961	2.32E-21
UVM	TSG	PNPT1	DICER1	0.829229084	2.12E-21
UVM	TSG	PNPT1	SIRT1	0.831053522	1.45E-21
UVM	TSG	PNPT1	CSNK1A1	0.831220672	1.40E-21
UVM	TSG	PNPT1	SP100	0.831665718	1.27E-21
UVM	TSG	PNPT1	CCAR1	0.832483769	1.07E-21
UVM	TSG	PNPT1	PPM1A	0.832599486	1.04E-21
UVM	TSG	PNPT1	VEZT	0.832868067	9.84E-22
UVM	TSG	PNPT1	PDS5B	0.833731471	8.18E-22
UVM	TSG	PNPT1	RB1CC1	0.835770304	5.27E-22
UVM	TSG	PNPT1	EZH2	0.839628384	2.25E-22
UVM	TSG	PNPT1	CHD1	0.839810864	2.16E-22
UVM	TSG	PNPT1	UHRF2	0.843105842	1.03E-22
UVM	TSG	PNPT1	NEDD4	0.844035624	8.30E-23
UVM	TSG	PNPT1	RBBP8	0.845405687	6.05E-23
UVM	TSG	PNPT1	TANK	0.846754457	4.41E-23
UVM	TSG	PNPT1	ANXA7	0.852887864	1.01E-23
UVM	TSG	PNPT1	MLH3	0.85593972	4.76E-24
UVM	TSG	PNPT1	GGNBP2	0.856957992	3.68E-24
UVM	TSG	PNPT1	MSH2	0.858247902	2.65E-24
UVM	TSG	PNPT1	GTPBP4	0.85935661	2.00E-24
UVM	TSG	PNPT1	NAPEPLD	0.860807268	1.37E-24
UVM	TSG	PNPT1	DMTF1	0.861926349	1.02E-24
UVM	TSG	PNPT1	BRCA2	0.862820258	8.09E-25
UVM	TSG	PNPT1	BMPR2	0.863230236	7.25E-25
UVM	TSG	PNPT1	TOPORS	0.864796198	4.77E-25
UVM	TSG	PNPT1	INTS6	0.865592177	3.85E-25
UVM	TSG	PNPT1	LIN9	0.867959274	2.02E-25
UVM	TSG	PNPT1	BMPR1A	0.871080605	8.45E-26
UVM	TSG	PNPT1	FAM188A	0.87201598	6.48E-26
UVM	TSG	PNPT1	APAF1	0.877375076	1.36E-26
UVM	TSG	PNPT1	CUL5	0.882810793	2.58E-27
UVM	TSG	PNPT1	KRIT1	0.885516597	1.09E-27
UVM	TSG	PNPT1	ATM	0.887196034	6.35E-28
UVM	TSG	PNPT1	WDR11	0.887820063	5.17E-28
UVM	TSG	PNPT1	CUL2	0.890841602	1.89E-28
UVM	TSG	PNPT1	RINT1	0.895328135	4.02E-29
UVM	TSG	PNPT1	PRKAA1	0.897890634	1.61E-29
UVM	TSG	PNPT1	DCLRE1A	0.898992058	1.08E-29
UVM	TSG	PNPT1	GORAB	0.902313319	3.12E-30
UVM	TSG	PNPT1	SMCHD1	0.907087983	4.84E-31
UVM	TSG	PNPT1	CDC73	0.90770177	3.78E-31
UVM	TSG	PNPT1	SUZ12	0.909865726	1.56E-31

Top

Protein structure

Protein 3D structure
Visit iCn3D.

Top

Protein-Protein Interaction

Protein-protein interaction networks
* Overlap between up-regulated DEGs (log2FC<-1 and adj.P<0.05) and STRING PPI network (center: Translation factor, node: DEGs, edges: weighted by -log2(adj.P))

Overlap between down-regulated DEGs (log2FC>1 and adj.P<0.05) and STRING PPI network (center: Translation factor, node: DEGs, edges: weighted by -log2(adj.P))

* Edge colors based on TCGA cancer types.

* Overlap between DEGs (log2FC>1 and adj.P<0.05) and STRING PPI network per cancer (center: Translation factor, node: DEGs, node color: log2FC, edges: weighted by -log2(adj.P))

Cancer type	Translation factor	Interacting protein coding gene	FC	adj.pval
KIRP	PNPT1	EXOSC1	-1.33151185162103	0.000133869703859091
KICH	PNPT1	EXOSC10	1.24998522750894	0.000139892101287842
THCA	PNPT1	SUPV3L1	1.16309404438803	0.000195372413806617
LIHC	PNPT1	EXOSC9	-2.50953051098706	0.000201991820198738
THCA	PNPT1	EXOSC4	-1.11463631149166	0.000207398306454043
STAD	PNPT1	EXOSC9	-1.45226188044018	0.000306400004774332
KICH	PNPT1	EXOSC1	1.88198428035622	0.000556409358978271
PRAD	PNPT1	EXOSC4	-4.70182019022102	0.000648342999076925
COAD	PNPT1	EXOSC9	-2.08916035369094	0.000664144754409791
ESCA	PNPT1	EXOSC5	-3.73448090208876	0.0009765625
STAD	PNPT1	SUPV3L1	-2.73690808019925	0.00133262807503343
LIHC	PNPT1	EXOSC4	2.269913876739	0.00228509329229136
ESCA	PNPT1	DIS3	1.13528932331943	0.0029296875
ESCA	PNPT1	EXOSC9	-1.29616499696761	0.0029296875
LIHC	PNPT1	DIS3	1.39544325555059	0.00915034805063108
KICH	PNPT1	EXOSC7	1.11626022550606	0.00963503122329712
HNSC	PNPT1	EXOSC6	1.57129641372128	0.0154582375123482
UCEC	PNPT1	EXOSC7	1.37141709218626	0.015625
CHOL	PNPT1	EXOSC6	-2.43444454012501	0.0390625
LUAD	PNPT1	EXOSC9	-1.70965354341598	0.0417265102143948
BRCA	PNPT1	EXOSC1	-3.22250485955442	1.01918341406027e-11
KIRC	PNPT1	EXOSC5	-2.76908351745065	1.09859684701495e-11
KIRC	PNPT1	EXOSC9	-1.80547222200586	1.11862284037858e-09
PRAD	PNPT1	EXOSC5	-2.70222350851716	1.26099370313262e-05
BRCA	PNPT1	EXOSC4	-1.39844269640225	1.3684078260725e-15
THCA	PNPT1	EXOSC5	-1.76982463038815	1.55304155962675e-06
LUAD	PNPT1	EXOSC5	-2.21263383713822	1.8775400044567e-09
LUAD	PNPT1	SUPV3L1	-1.36451925050335	3.8615985200212e-08
LUAD	PNPT1	EXOSC4	-2.39057665546458	5.24732369463512e-07
LUAD	PNPT1	EXOSC10	-5.48154088649683	6.13939009668372e-06
KIRP	PNPT1	EXOSC5	-1.57899571115575	6.79492950439454e-06
BRCA	PNPT1	EXOSC5	-1.24930553971161	9.66917351405126e-09

Protein-protein interactors with this translation factor (BIOGRID-3.4.160)

PPI interactors with PNPT1

ICT1, SIRT7, DPY30, NUP153, GATC, HSPB1, NCL, NUP214, NUP107, PDLIM1, PRKCSH, NCAPD2, RANGAP1, PTBP1, GRSF1, NXF1, FAHD1, PPA2, HMGCL, CLTB, EIF4A1, PMPCA, PMPCB, NTRK1, LTN1, TBRG4, SUPV3L1, SERPINA12, TMED2, ACAD9, ATP5D, MRPL12, YAF2, EFTUD2, CDC34, MRM1, HSPD1, PDK1, TRMT61B, KIAA1429, AMT, BCL2L13, GFM1, SND1, ADARB1, PLEKHA4, XIRP2, GBP4, PARL, E, nsp15, nsp16, ORF6, IMMP2L, HSCB, AUH, C12orf65, C1QBP, C21orf33, C6orf203, CS, DDX28, FASTKD2, FASTKD3, FASTKD5, GFM2, HINT2, LONP1, LRPPRC, MDH2, METTL15, METTL17, MRPL11, MRPS12, MRPS26, MRRF, MTERF3, MTG1, MTG2, MTIF2, MTIF3, MTRF1, MTRF1L, RPUSD4, SLIRP, SSBP1, TACO1, TFAM, TRUB2, TSFM, TUFM, VWA8, EXD2, CLPP, Apc2, AARS2, COX8A, PDHA1, TRAP1, NUDCD2, UQCRFS1, PFDN5, TCL1A, MALSU1, LRFN2, PDE12, MRPL23, CALR3, QRSL1, TMEM183A, WIF1, OSGEP, PRR3, AURKB, FTSJ2, ZSCAN31, SLC25A10, MRPL42, YARS2, CIART, MRPS17, SERBP1, PCDHA4, EP300,

Top

Mutations

Clinically associated variants from ClinVar.

Gene	Chr	Position	RefSeq	VarSeq	RefSeeq	VarType	Pathogenic	Disease	VarInfo
PNPT1	chr2	55863066	TTCTA	T	Microsatellite	Benign	not_provided	SO:0001624\|3_prime_UTR_variant	SO:0001624\|3_prime_UTR_variant
PNPT1	chr2	55863110	CTA	C	Deletion	Benign	not_provided	SO:0001624\|3_prime_UTR_variant	SO:0001624\|3_prime_UTR_variant
PNPT1	chr2	55863213	A	T	single_nucleotide_variant	Likely_benign	not_provided	SO:0001624\|3_prime_UTR_variant	SO:0001624\|3_prime_UTR_variant
PNPT1	chr2	55863301	A	G	single_nucleotide_variant	Benign	not_provided	SO:0001624\|3_prime_UTR_variant	SO:0001624\|3_prime_UTR_variant
PNPT1	chr2	55863360	T	TA	Duplication	Benign	Combined_oxidative_phosphorylation_deficiency_13\|Deafness,_autosomal_recessive_70\|not_specified	SO:0001624\|3_prime_UTR_variant	SO:0001624\|3_prime_UTR_variant
PNPT1	chr2	55863463	G	A	single_nucleotide_variant	Uncertain_significance	not_provided	SO:0001583\|missense_variant	SO:0001583\|missense_variant
PNPT1	chr2	55863490	A	G	single_nucleotide_variant	Uncertain_significance	not_provided	SO:0001583\|missense_variant	SO:0001583\|missense_variant
PNPT1	chr2	55863511	C	T	single_nucleotide_variant	Likely_pathogenic	Combined_oxidative_phosphorylation_deficiency_13	SO:0001583\|missense_variant	SO:0001583\|missense_variant
PNPT1	chr2	55863562	C	G	single_nucleotide_variant	Likely_benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
PNPT1	chr2	55863589	T	C	single_nucleotide_variant	Likely_benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
PNPT1	chr2	55864403	C	T	single_nucleotide_variant	Likely_benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
PNPT1	chr2	55864738	G	GA	Duplication	Benign	not_specified\|not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
PNPT1	chr2	55864745	A	C	single_nucleotide_variant	Likely_benign	not_specified	SO:0001627\|intron_variant	SO:0001627\|intron_variant
PNPT1	chr2	55864752	A	T	single_nucleotide_variant	Likely_benign	not_specified	SO:0001627\|intron_variant	SO:0001627\|intron_variant
PNPT1	chr2	55864753	A	G	single_nucleotide_variant	Likely_benign	not_specified	SO:0001627\|intron_variant	SO:0001627\|intron_variant
PNPT1	chr2	55865038	G	T	single_nucleotide_variant	Benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
PNPT1	chr2	55867756	T	A	single_nucleotide_variant	Uncertain_significance	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
PNPT1	chr2	55867763	T	C	single_nucleotide_variant	Uncertain_significance	Deafness,_autosomal_recessive_70\|not_provided	SO:0001583\|missense_variant	SO:0001583\|missense_variant
PNPT1	chr2	55867773	C	A	single_nucleotide_variant	Pathogenic	Combined_oxidative_phosphorylation_deficiency_13	SO:0001583\|missense_variant	SO:0001583\|missense_variant
PNPT1	chr2	55867845	A	G	single_nucleotide_variant	Benign	not_specified\|not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
PNPT1	chr2	55867856	T	G	single_nucleotide_variant	Likely_benign	not_specified	SO:0001627\|intron_variant	SO:0001627\|intron_variant
PNPT1	chr2	55867938	A	G	single_nucleotide_variant	Benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
PNPT1	chr2	55870304	T	G	single_nucleotide_variant	Likely_benign	not_provided	SO:0001819\|synonymous_variant	SO:0001819\|synonymous_variant
PNPT1	chr2	55870319	T	C	single_nucleotide_variant	Benign/Likely_benign	not_provided	SO:0001819\|synonymous_variant	SO:0001819\|synonymous_variant
PNPT1	chr2	55870323	G	A	single_nucleotide_variant	Uncertain_significance	not_provided	SO:0001583\|missense_variant	SO:0001583\|missense_variant
PNPT1	chr2	55870455	T	A	single_nucleotide_variant	Uncertain_significance	Combined_oxidative_phosphorylation_deficiency_13	SO:0001583\|missense_variant	SO:0001583\|missense_variant
PNPT1	chr2	55870507	G	A	single_nucleotide_variant	Uncertain_significance	not_provided	SO:0001583\|missense_variant	SO:0001583\|missense_variant
PNPT1	chr2	55870529	C	T	single_nucleotide_variant	Benign/Likely_benign	not_specified\|not_provided	SO:0001819\|synonymous_variant	SO:0001819\|synonymous_variant
PNPT1	chr2	55870538	A	G	single_nucleotide_variant	Likely_benign	not_provided	SO:0001819\|synonymous_variant	SO:0001819\|synonymous_variant
PNPT1	chr2	55870539	TCCA	T	Deletion	Uncertain_significance	Deafness,_autosomal_recessive_70\|not_provided	SO:0001822\|inframe_deletion	SO:0001822\|inframe_deletion
PNPT1	chr2	55870544	C	T	single_nucleotide_variant	Uncertain_significance	not_provided	SO:0001819\|synonymous_variant	SO:0001819\|synonymous_variant
PNPT1	chr2	55870554	G	A	single_nucleotide_variant	Uncertain_significance	not_provided	SO:0001583\|missense_variant	SO:0001583\|missense_variant
PNPT1	chr2	55870577	G	A	single_nucleotide_variant	Likely_benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
PNPT1	chr2	55870697	T	C	single_nucleotide_variant	Benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
PNPT1	chr2	55870827	A	G	single_nucleotide_variant	Benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
PNPT1	chr2	55870873	CA	C	Deletion	Benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
PNPT1	chr2	55871762	C	ATG	Indel	Likely_benign	not_specified	SO:0001627\|intron_variant	SO:0001627\|intron_variant
PNPT1	chr2	55871771	C	T	single_nucleotide_variant	Likely_pathogenic	Combined_oxidative_phosphorylation_deficiency_13	SO:0001575\|splice_donor_variant	SO:0001575\|splice_donor_variant
PNPT1	chr2	55871797	G	A	single_nucleotide_variant	Likely_benign	not_provided	SO:0001819\|synonymous_variant	SO:0001819\|synonymous_variant
PNPT1	chr2	55871862	C	T	single_nucleotide_variant	Likely_benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
PNPT1	chr2	55871863	G	A	single_nucleotide_variant	Likely_benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
PNPT1	chr2	55872076	G	A	single_nucleotide_variant	Benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
PNPT1	chr2	55872081	G	A	single_nucleotide_variant	Benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
PNPT1	chr2	55872259	T	C	single_nucleotide_variant	Benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
PNPT1	chr2	55872488	A	C	single_nucleotide_variant	Pathogenic	Combined_oxidative_phosphorylation_deficiency_13\|Deafness,_autosomal_recessive_70	SO:0001819\|synonymous_variant	SO:0001819\|synonymous_variant
PNPT1	chr2	55872526	A	C	single_nucleotide_variant	Likely_benign	not_provided	SO:0001583\|missense_variant	SO:0001583\|missense_variant
PNPT1	chr2	55872535	T	G	single_nucleotide_variant	Conflicting_interpretations_of_pathogenicity	not_provided	SO:0001583\|missense_variant	SO:0001583\|missense_variant
PNPT1	chr2	55872538	T	C	single_nucleotide_variant	Benign	not_specified\|not_provided	SO:0001583\|missense_variant	SO:0001583\|missense_variant
PNPT1	chr2	55872550	A	G	single_nucleotide_variant	Likely_benign	not_provided	SO:0001819\|synonymous_variant	SO:0001819\|synonymous_variant
PNPT1	chr2	55872717	T	C	single_nucleotide_variant	Likely_benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
PNPT1	chr2	55873123	C	T	single_nucleotide_variant	Likely_benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
PNPT1	chr2	55873215	G	A	single_nucleotide_variant	Benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
PNPT1	chr2	55873301	T	A	single_nucleotide_variant	Benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
PNPT1	chr2	55873357	G	C	single_nucleotide_variant	Benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
PNPT1	chr2	55873385	C	G	single_nucleotide_variant	Benign	not_specified\|not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
PNPT1	chr2	55873407	A	G	single_nucleotide_variant	Likely_benign	not_provided	SO:0001819\|synonymous_variant	SO:0001819\|synonymous_variant
PNPT1	chr2	55873456	G	C	single_nucleotide_variant	Uncertain_significance	Combined_oxidative_phosphorylation_deficiency_13\|not_provided	SO:0001583\|missense_variant	SO:0001583\|missense_variant
PNPT1	chr2	55873529	CA	C	Deletion	Benign	not_specified	SO:0001627\|intron_variant	SO:0001627\|intron_variant
PNPT1	chr2	55873562	TA	T	Deletion	Likely_pathogenic	not_provided	SO:0001589\|frameshift_variant	SO:0001589\|frameshift_variant
PNPT1	chr2	55873592	G	A	single_nucleotide_variant	Benign	not_specified\|not_provided	SO:0001819\|synonymous_variant	SO:0001819\|synonymous_variant
PNPT1	chr2	55873605	T	C	single_nucleotide_variant	Pathogenic	Deafness,_autosomal_recessive_70	SO:0001583\|missense_variant	SO:0001583\|missense_variant
PNPT1	chr2	55873908	TGTAA	T	Deletion	Benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
PNPT1	chr2	55874293	A	T	single_nucleotide_variant	Benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
PNPT1	chr2	55874332	T	C	single_nucleotide_variant	Likely_benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
PNPT1	chr2	55874492	G	C	single_nucleotide_variant	Conflicting_interpretations_of_pathogenicity	Combined_oxidative_phosphorylation_deficiency_13\|not_provided	SO:0001583\|missense_variant	SO:0001583\|missense_variant
PNPT1	chr2	55874501	C	T	single_nucleotide_variant	Uncertain_significance	not_provided	SO:0001583\|missense_variant	SO:0001583\|missense_variant
PNPT1	chr2	55874518	A	T	single_nucleotide_variant	Uncertain_significance	not_provided	SO:0001819\|synonymous_variant	SO:0001819\|synonymous_variant
PNPT1	chr2	55874521	C	T	single_nucleotide_variant	Uncertain_significance	not_provided	SO:0001819\|synonymous_variant	SO:0001819\|synonymous_variant
PNPT1	chr2	55874556	C	G	single_nucleotide_variant	Pathogenic	Combined_oxidative_phosphorylation_deficiency_13	SO:0001583\|missense_variant	SO:0001583\|missense_variant
PNPT1	chr2	55874559	C	T	single_nucleotide_variant	Conflicting_interpretations_of_pathogenicity	Combined_oxidative_phosphorylation_deficiency_13\|Deafness,_autosomal_recessive_70\|not_specified\|not_provided	SO:0001583\|missense_variant	SO:0001583\|missense_variant
PNPT1	chr2	55874565	C	A	single_nucleotide_variant	Conflicting_interpretations_of_pathogenicity	Combined_oxidative_phosphorylation_deficiency_13\|Deafness,_autosomal_recessive_70\|Neurodevelopmental_disorder\|Inborn_genetic_diseases\|not_provided	SO:0001583\|missense_variant	SO:0001583\|missense_variant
PNPT1	chr2	55874598	G	A	single_nucleotide_variant	Likely_benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
PNPT1	chr2	55874811	C	T	single_nucleotide_variant	Benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
PNPT1	chr2	55881816	C	T	single_nucleotide_variant	Benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
PNPT1	chr2	55881954	TCCTGCCTTGGCCTCCCAAGGCTCATG	T	Deletion	Benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
PNPT1	chr2	55882023	T	C	single_nucleotide_variant	Likely_benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
PNPT1	chr2	55882035	C	G	single_nucleotide_variant	Pathogenic	Combined_oxidative_phosphorylation_deficiency_13	SO:0001583\|missense_variant	SO:0001583\|missense_variant
PNPT1	chr2	55882060	G	A	single_nucleotide_variant	Likely_benign	not_provided	SO:0001819\|synonymous_variant	SO:0001819\|synonymous_variant
PNPT1	chr2	55882077	T	C	single_nucleotide_variant	Likely_pathogenic	not_provided	SO:0001583\|missense_variant	SO:0001583\|missense_variant
PNPT1	chr2	55882092	T	C	single_nucleotide_variant	Likely_benign	not_specified	SO:0001627\|intron_variant	SO:0001627\|intron_variant
PNPT1	chr2	55882132	T	A	single_nucleotide_variant	Likely_benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
PNPT1	chr2	55882247	A	T	single_nucleotide_variant	Likely_benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
PNPT1	chr2	55883273	C	T	single_nucleotide_variant	Likely_benign	not_provided	SO:0001819\|synonymous_variant	SO:0001819\|synonymous_variant
PNPT1	chr2	55883283	T	C	single_nucleotide_variant	Pathogenic	Deafness,_autosomal_recessive_70	SO:0001583\|missense_variant	SO:0001583\|missense_variant
PNPT1	chr2	55883308	G	A	single_nucleotide_variant	Uncertain_significance	Combined_oxidative_phosphorylation_deficiency_13\|not_provided	SO:0001583\|missense_variant	SO:0001583\|missense_variant
PNPT1	chr2	55883317	G	A	single_nucleotide_variant	Pathogenic	Inborn_genetic_diseases	SO:0001587\|nonsense	SO:0001587\|nonsense
PNPT1	chr2	55883317	G	T	single_nucleotide_variant	Benign	Combined_oxidative_phosphorylation_deficiency_13\|Deafness,_autosomal_recessive_70\|not_specified\|not_provided	SO:0001819\|synonymous_variant	SO:0001819\|synonymous_variant
PNPT1	chr2	55883325	A	G	single_nucleotide_variant	Uncertain_significance	not_provided	SO:0001583\|missense_variant	SO:0001583\|missense_variant
PNPT1	chr2	55883333	C	T	single_nucleotide_variant	Likely_benign	not_provided	SO:0001819\|synonymous_variant	SO:0001819\|synonymous_variant
PNPT1	chr2	55883346	G	C	single_nucleotide_variant	Conflicting_interpretations_of_pathogenicity	Combined_oxidative_phosphorylation_deficiency_13\|not_provided	SO:0001583\|missense_variant	SO:0001583\|missense_variant
PNPT1	chr2	55883565	T	C	single_nucleotide_variant	Likely_benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
PNPT1	chr2	55883713	C	A	single_nucleotide_variant	Benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
PNPT1	chr2	55883733	C	A	single_nucleotide_variant	Benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
PNPT1	chr2	55886871	G	A	single_nucleotide_variant	Benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
PNPT1	chr2	55887075	A	G	single_nucleotide_variant	Likely_benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
PNPT1	chr2	55887160	GC	G	Deletion	Likely_benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
PNPT1	chr2	55887176	T	C	single_nucleotide_variant	Benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
PNPT1	chr2	55887282	T	G	single_nucleotide_variant	Likely_benign	not_specified	SO:0001627\|intron_variant	SO:0001627\|intron_variant
PNPT1	chr2	55887325	C	A	single_nucleotide_variant	Likely_benign	not_provided	SO:0001819\|synonymous_variant	SO:0001819\|synonymous_variant
PNPT1	chr2	55887325	C	T	single_nucleotide_variant	Benign/Likely_benign	not_specified\|not_provided	SO:0001819\|synonymous_variant	SO:0001819\|synonymous_variant
PNPT1	chr2	55887344	A	G	single_nucleotide_variant	Likely_benign	not_specified	SO:0001627\|intron_variant	SO:0001627\|intron_variant
PNPT1	chr2	55889062	G	A	single_nucleotide_variant	Benign	Combined_oxidative_phosphorylation_deficiency_13\|Deafness,_autosomal_recessive_70\|not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
PNPT1	chr2	55889107	C	T	single_nucleotide_variant	Likely_benign	not_provided	SO:0001583\|missense_variant	SO:0001583\|missense_variant
PNPT1	chr2	55889149	C	T	single_nucleotide_variant	Uncertain_significance	not_provided	SO:0001583\|missense_variant	SO:0001583\|missense_variant
PNPT1	chr2	55889336	A	G	single_nucleotide_variant	Likely_benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
PNPT1	chr2	55889454	G	A	single_nucleotide_variant	Benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
PNPT1	chr2	55889466	G	A	single_nucleotide_variant	Benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
PNPT1	chr2	55894085	T	A	single_nucleotide_variant	Likely_benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
PNPT1	chr2	55894090	A	G	single_nucleotide_variant	Benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
PNPT1	chr2	55894118	TA	T	Deletion	Likely_benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
PNPT1	chr2	55894119	A	G	single_nucleotide_variant	Likely_benign	not_specified	SO:0001627\|intron_variant	SO:0001627\|intron_variant
PNPT1	chr2	55894126	CTG	C	Microsatellite	Pathogenic	not_provided	SO:0001589\|frameshift_variant	SO:0001589\|frameshift_variant
PNPT1	chr2	55894142	T	C	single_nucleotide_variant	Pathogenic	Combined_oxidative_phosphorylation_deficiency_13	SO:0001583\|missense_variant	SO:0001583\|missense_variant
PNPT1	chr2	55894153	T	C	single_nucleotide_variant	Likely_benign	not_provided	SO:0001819\|synonymous_variant	SO:0001819\|synonymous_variant
PNPT1	chr2	55894181	A	G	single_nucleotide_variant	Uncertain_significance	Combined_oxidative_phosphorylation_deficiency_13	SO:0001583\|missense_variant	SO:0001583\|missense_variant
PNPT1	chr2	55894203	G	A	single_nucleotide_variant	Conflicting_interpretations_of_pathogenicity	not_provided	SO:0001583\|missense_variant	SO:0001583\|missense_variant
PNPT1	chr2	55894232	T	A	single_nucleotide_variant	Benign	not_specified\|not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
PNPT1	chr2	55894240	T	C	single_nucleotide_variant	Likely_benign	not_specified	SO:0001627\|intron_variant	SO:0001627\|intron_variant
PNPT1	chr2	55894243	G	A	single_nucleotide_variant	Benign	not_specified\|not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
PNPT1	chr2	55894247	T	C	single_nucleotide_variant	Benign	Combined_oxidative_phosphorylation_deficiency_13\|Deafness,_autosomal_recessive_70\|not_specified\|not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
PNPT1	chr2	55894269	A	T	single_nucleotide_variant	Likely_benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
PNPT1	chr2	55894428	G	A	single_nucleotide_variant	Benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
PNPT1	chr2	55894456	G	A	single_nucleotide_variant	Benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
PNPT1	chr2	55894720	CA	C	Deletion	Benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
PNPT1	chr2	55894858	G	A	single_nucleotide_variant	Likely_benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
PNPT1	chr2	55894989	A	T	single_nucleotide_variant	Likely_benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
PNPT1	chr2	55895002	G	C	single_nucleotide_variant	Uncertain_significance	not_specified	SO:0001587\|nonsense	SO:0001587\|nonsense
PNPT1	chr2	55895004	A	G	single_nucleotide_variant	Uncertain_significance	not_provided	SO:0001583\|missense_variant	SO:0001583\|missense_variant
PNPT1	chr2	55895048	T	C	single_nucleotide_variant	Uncertain_significance	not_provided	SO:0001583\|missense_variant	SO:0001583\|missense_variant
PNPT1	chr2	55895097	T	C	single_nucleotide_variant	Likely_benign	not_specified	SO:0001627\|intron_variant	SO:0001627\|intron_variant
PNPT1	chr2	55895305	T	C	single_nucleotide_variant	Benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
PNPT1	chr2	55895321	T	C	single_nucleotide_variant	Benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
PNPT1	chr2	55898203	A	G	single_nucleotide_variant	Benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
PNPT1	chr2	55898290	C	G	single_nucleotide_variant	Benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
PNPT1	chr2	55898486	T	C	single_nucleotide_variant	Benign/Likely_benign	not_specified\|not_provided	SO:0001583\|missense_variant	SO:0001583\|missense_variant
PNPT1	chr2	55898929	A	G	single_nucleotide_variant	Benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
PNPT1	chr2	55898930	C	T	single_nucleotide_variant	Benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
PNPT1	chr2	55898962	AAAAAC	A	Microsatellite	Likely_benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
PNPT1	chr2	55899092	T	C	single_nucleotide_variant	Likely_benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
PNPT1	chr2	55899129	CT	C	Deletion	Pathogenic	Deafness,_autosomal_recessive_70	SO:0001589\|frameshift_variant	SO:0001589\|frameshift_variant
PNPT1	chr2	55899142	G	A	single_nucleotide_variant	Benign	not_specified\|not_provided	SO:0001819\|synonymous_variant	SO:0001819\|synonymous_variant
PNPT1	chr2	55899176	G	A	single_nucleotide_variant	Uncertain_significance	not_provided	SO:0001583\|missense_variant	SO:0001583\|missense_variant
PNPT1	chr2	55899228	A	T	single_nucleotide_variant	Benign	Combined_oxidative_phosphorylation_deficiency_13\|Deafness,_autosomal_recessive_70\|not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
PNPT1	chr2	55899425	T	C	single_nucleotide_variant	Benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
PNPT1	chr2	55900032	G	A	single_nucleotide_variant	Likely_benign	not_provided	SO:0001583\|missense_variant	SO:0001583\|missense_variant
PNPT1	chr2	55900033	A	T	single_nucleotide_variant	Benign	not_specified\|not_provided	SO:0001819\|synonymous_variant	SO:0001819\|synonymous_variant
PNPT1	chr2	55900042	C	G	single_nucleotide_variant	Benign/Likely_benign	not_specified\|not_provided	SO:0001819\|synonymous_variant	SO:0001819\|synonymous_variant
PNPT1	chr2	55900105	T	C	single_nucleotide_variant	Benign/Likely_benign	not_provided	SO:0001819\|synonymous_variant	SO:0001819\|synonymous_variant
PNPT1	chr2	55900134	G	T	single_nucleotide_variant	Pathogenic	Combined_oxidative_phosphorylation_deficiency_13	SO:0001583\|missense_variant	SO:0001583\|missense_variant
PNPT1	chr2	55900155	C	A	single_nucleotide_variant	Likely_benign	not_provided	SO:0001583\|missense_variant	SO:0001583\|missense_variant
PNPT1	chr2	55900206	C	G	single_nucleotide_variant	Conflicting_interpretations_of_pathogenicity	Combined_oxidative_phosphorylation_deficiency_13\|Deafness,_autosomal_recessive_70\|not_provided	SO:0001583\|missense_variant	SO:0001583\|missense_variant
PNPT1	chr2	55900217	A	T	single_nucleotide_variant	Uncertain_significance	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
PNPT1	chr2	55900223	A	G	single_nucleotide_variant	Likely_benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
PNPT1	chr2	55900224	G	A	single_nucleotide_variant	Likely_benign	not_specified	SO:0001627\|intron_variant	SO:0001627\|intron_variant
PNPT1	chr2	55900231	G	GA	Duplication	Benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
PNPT1	chr2	55900283	A	G	single_nucleotide_variant	Benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
PNPT1	chr2	55900459	A	G	single_nucleotide_variant	Benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
PNPT1	chr2	55906552	T	C	single_nucleotide_variant	Likely_benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
PNPT1	chr2	55906768	G	C	single_nucleotide_variant	Likely_benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
PNPT1	chr2	55906884	T	G	single_nucleotide_variant	Likely_benign	not_provided	SO:0001819\|synonymous_variant	SO:0001819\|synonymous_variant
PNPT1	chr2	55906921	C	T	single_nucleotide_variant	Likely_pathogenic	not_provided	SO:0001583\|missense_variant	SO:0001583\|missense_variant
PNPT1	chr2	55906936	A	G	single_nucleotide_variant	Benign	not_specified\|not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
PNPT1	chr2	55907560	TA	T	Deletion	Benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
PNPT1	chr2	55907560	TAAAAAAAA	T	Deletion	Likely_benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
PNPT1	chr2	55907757	G	A	single_nucleotide_variant	Likely_benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
PNPT1	chr2	55907886	C	T	single_nucleotide_variant	Likely_pathogenic	Combined_oxidative_phosphorylation_deficiency_13	SO:0001583\|missense_variant	SO:0001583\|missense_variant
PNPT1	chr2	55907891	G	A	single_nucleotide_variant	Uncertain_significance	not_provided	SO:0001583\|missense_variant	SO:0001583\|missense_variant
PNPT1	chr2	55907893	A	G	single_nucleotide_variant	Likely_benign	not_provided	SO:0001819\|synonymous_variant	SO:0001819\|synonymous_variant
PNPT1	chr2	55907990	C	T	single_nucleotide_variant	Likely_pathogenic	not_provided	SO:0001583\|missense_variant	SO:0001583\|missense_variant
PNPT1	chr2	55907991	G	A	single_nucleotide_variant	Likely_benign	not_specified	SO:0001819\|synonymous_variant	SO:0001819\|synonymous_variant
PNPT1	chr2	55908014	G	A	single_nucleotide_variant	Conflicting_interpretations_of_pathogenicity	Combined_oxidative_phosphorylation_deficiency_13\|not_provided	SO:0001583\|missense_variant	SO:0001583\|missense_variant
PNPT1	chr2	55908065	G	GA	Duplication	Likely_benign	not_specified	SO:0001627\|intron_variant	SO:0001627\|intron_variant
PNPT1	chr2	55908317	G	C	single_nucleotide_variant	Benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
PNPT1	chr2	55910674	G	A	single_nucleotide_variant	Likely_benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
PNPT1	chr2	55910710	T	C	single_nucleotide_variant	Benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
PNPT1	chr2	55910747	C	CA	Duplication	Benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
PNPT1	chr2	55910747	CA	C	Deletion	Likely_benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
PNPT1	chr2	55910944	T	C	single_nucleotide_variant	Likely_benign	not_specified	SO:0001819\|synonymous_variant	SO:0001819\|synonymous_variant
PNPT1	chr2	55910950	G	A	single_nucleotide_variant	Likely_benign	not_specified	SO:0001819\|synonymous_variant	SO:0001819\|synonymous_variant
PNPT1	chr2	55910952	GC	G	Deletion	Likely_pathogenic	Neurodevelopmental_disorder	SO:0001589\|frameshift_variant	SO:0001589\|frameshift_variant
PNPT1	chr2	55910954	G	A	single_nucleotide_variant	Likely_pathogenic	not_provided	SO:0001583\|missense_variant	SO:0001583\|missense_variant
PNPT1	chr2	55910955	G	A	single_nucleotide_variant	Uncertain_significance	not_provided	SO:0001583\|missense_variant	SO:0001583\|missense_variant
PNPT1	chr2	55910961	T	C	single_nucleotide_variant	Conflicting_interpretations_of_pathogenicity	Combined_oxidative_phosphorylation_deficiency_13\|not_provided	SO:0001583\|missense_variant	SO:0001583\|missense_variant
PNPT1	chr2	55910966	C	T	single_nucleotide_variant	Likely_pathogenic	Combined_oxidative_phosphorylation_deficiency_13\|not_provided	SO:0001583\|missense_variant	SO:0001583\|missense_variant
PNPT1	chr2	55910970	C	T	single_nucleotide_variant	Pathogenic	Combined_oxidative_phosphorylation_deficiency_13	SO:0001574\|splice_acceptor_variant	SO:0001574\|splice_acceptor_variant
PNPT1	chr2	55910974	C	A	single_nucleotide_variant	Likely_benign	not_specified	SO:0001627\|intron_variant	SO:0001627\|intron_variant
PNPT1	chr2	55910979	G	T	single_nucleotide_variant	Likely_benign	not_specified	SO:0001627\|intron_variant	SO:0001627\|intron_variant
PNPT1	chr2	55912120	T	C	single_nucleotide_variant	Benign	Combined_oxidative_phosphorylation_deficiency_13\|Deafness,_autosomal_recessive_70\|not_specified\|not_provided	SO:0001583\|missense_variant	SO:0001583\|missense_variant
PNPT1	chr2	55912154	T	C	single_nucleotide_variant	Likely_benign	not_provided	SO:0001819\|synonymous_variant	SO:0001819\|synonymous_variant
PNPT1	chr2	55912185	T	A	single_nucleotide_variant	Pathogenic	Deafness,_autosomal_recessive_70	SO:0001574\|splice_acceptor_variant	SO:0001574\|splice_acceptor_variant
PNPT1	chr2	55912187	A	T	single_nucleotide_variant	Likely_benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
PNPT1	chr2	55912191	A	C	single_nucleotide_variant	Likely_benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
PNPT1	chr2	55912193	C	A	single_nucleotide_variant	Likely_benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
PNPT1	chr2	55912196	T	C	single_nucleotide_variant	Likely_benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
PNPT1	chr2	55913206	G	A	single_nucleotide_variant	Likely_benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
PNPT1	chr2	55913271	AT	A	Deletion	Benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
PNPT1	chr2	55913468	A	T	single_nucleotide_variant	Likely_benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
PNPT1	chr2	55913528	G	C	single_nucleotide_variant	Uncertain_significance	Combined_oxidative_phosphorylation_deficiency_13	SO:0001583\|missense_variant	SO:0001583\|missense_variant
PNPT1	chr2	55913551	G	A	single_nucleotide_variant	Uncertain_significance	not_provided	SO:0001583\|missense_variant	SO:0001583\|missense_variant
PNPT1	chr2	55913588	T	A	single_nucleotide_variant	Benign/Likely_benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
PNPT1	chr2	55913592	G	A	single_nucleotide_variant	Likely_benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
PNPT1	chr2	55913592	G	C	single_nucleotide_variant	Likely_benign	not_specified	SO:0001627\|intron_variant	SO:0001627\|intron_variant
PNPT1	chr2	55913644	C	A	single_nucleotide_variant	Likely_benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
PNPT1	chr2	55914573	C	CA	Duplication	Benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
PNPT1	chr2	55914621	T	C	single_nucleotide_variant	Benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
PNPT1	chr2	55914794	A	G	single_nucleotide_variant	Pathogenic	Combined_oxidative_phosphorylation_deficiency_13	SO:0001583\|missense_variant	SO:0001583\|missense_variant
PNPT1	chr2	55914808	C	G	single_nucleotide_variant	Uncertain_significance	not_provided	SO:0001583\|missense_variant	SO:0001583\|missense_variant
PNPT1	chr2	55914810	G	C	single_nucleotide_variant	Likely_benign	not_provided	SO:0001819\|synonymous_variant	SO:0001819\|synonymous_variant
PNPT1	chr2	55915128	A	AT	Duplication	Likely_benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
PNPT1	chr2	55915128	AT	A	Deletion	Likely_benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
PNPT1	chr2	55920663	T	C	single_nucleotide_variant	Benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
PNPT1	chr2	55920749	C	T	single_nucleotide_variant	Benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
PNPT1	chr2	55920792	C	G	single_nucleotide_variant	Benign/Likely_benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
PNPT1	chr2	55920822	G	C	single_nucleotide_variant	Likely_pathogenic	Deafness,_autosomal_recessive_70	SO:0001583\|missense_variant	SO:0001583\|missense_variant
PNPT1	chr2	55920830	C	T	single_nucleotide_variant	Likely_benign	not_provided	SO:0001819\|synonymous_variant	SO:0001819\|synonymous_variant
PNPT1	chr2	55920837	C	G	single_nucleotide_variant	Benign/Likely_benign	not_specified\|not_provided	SO:0001583\|missense_variant	SO:0001583\|missense_variant
PNPT1	chr2	55920862	A	G	single_nucleotide_variant	Likely_benign	not_provided	SO:0001819\|synonymous_variant	SO:0001819\|synonymous_variant
PNPT1	chr2	55920938	G	A	single_nucleotide_variant	Likely_benign	not_provided	SO:0001819\|synonymous_variant	SO:0001819\|synonymous_variant
PNPT1	chr2	55920983	G	C	single_nucleotide_variant	Likely_benign	not_specified	SO:0002153\|genic_upstream_transcript_variant	SO:0002153\|genic_upstream_transcript_variant
PNPT1	chr2	55921006	C	T	single_nucleotide_variant	Likely_benign	not_specified
PNPT1	chr2	55921116	C	G	single_nucleotide_variant	Benign	not_provided

nsSNVs with sample frequency (size of circle) from TCGA 33 cancers.

SNVs and Indels

Gene	Cancer type	Chromosome	Start	End	RefSeeq	MutSeq	Mutation type	AAchange	# samples
PNPT1	KIRP	chr2	55908004	55908004	A	G	Missense_Mutation	p.L168P	4
PNPT1	SKCM	chr2	55894164	55894164	G	C	Missense_Mutation	p.L380V	3
PNPT1	ESCA	chr2	55912086	55912086	C	T	Missense_Mutation	p.R132Q	3
PNPT1	UCS	chr2	55872564	55872564	G	A	Missense_Mutation	p.A581V	3
PNPT1	BLCA	chr2	55883317	55883317	G	T	Silent		3
PNPT1	COAD	chr2	55863478	55863478	C	T	Missense_Mutation	p.R749Q	3
PNPT1	UCEC	chr2	55874510	55874510	T	G	Missense_Mutation	p.E525A	3
PNPT1	BLCA	chr2	55895089	55895089	T	-	Frame_Shift_Del	p.K327fs	3
PNPT1	PAAD	chr2	55874502	55874502	G	A	Missense_Mutation	p.R528C	3
PNPT1	UCEC	chr2	55874529	55874529	G	T	Missense_Mutation	p.P519T	3
PNPT1	PAAD	chr2	55871818	55871818	A	T	Missense_Mutation	p.F620L	3
PNPT1	BLCA	chr2	55895071	55895071	T	C	Silent	p.P333P	3
PNPT1	BLCA	chr2	55900125	55900125	G	T	Missense_Mutation	p.Q257K	2
PNPT1	LIHC	chr2	55887311	55887311	T	-	Frame_Shift_Del	p.N422fs	2
PNPT1	UCEC	chr2	55883448	55883448	A	C	Missense_Mutation	p.L448R	2
PNPT1	CESC	chr2	55883471	55883471	G	A	Silent		2
PNPT1	KIRP	chr2	55894199	55894199	C	A	Missense_Mutation		2
PNPT1	TGCT	chr2	55912120	55912120	T	C	Missense_Mutation		2
PNPT1	BLCA	chr2	55882034	55882034	C	T	Splice_Site		2
PNPT1	LIHC	chr2	55907883	55907883	G	-	Frame_Shift_Del	p.L177fs	2
PNPT1	LUAD	chr2	55874526	55874526	C	A	Nonsense_Mutation	p.E520*	2
PNPT1	SKCM	chr2	55920892	55920892	G	A	Silent	p.L23L	2
PNPT1	ESCA	chr2	55912086	55912086	C	T	Missense_Mutation		2
PNPT1	HNSC	chr2	55895069	55895069	T	G	Missense_Mutation	p.Y334S	2
PNPT1	LIHC	chr2	55910944	55910944	T	A	Silent	p.P143P	2
PNPT1	STAD	chr2	55863427	55863427	C	G	Missense_Mutation	p.R766T	2
PNPT1	LUAD	chr2	55912132	55912132	G	C	Missense_Mutation	p.L117V	2
PNPT1	STAD	chr2	55872550	55872550	A	G	Silent	p.L586L	2
PNPT1	THYM	chr2	55921011	55921011	G	T	Missense_Mutation		2
PNPT1	LIHC	chr2	55900045	55900045	A	-	Frame_Shift_Del	p.I283fs	2
PNPT1	SARC	chr2	55887311	55887311	T	C	Missense_Mutation		2
PNPT1	STAD	chr2	55870544	55870544	C	T	Silent	p.Q641Q	2
PNPT1	PAAD	chr2	55871818	55871818	A	T	Missense_Mutation		2
PNPT1	LUAD	chr2	55873549	55873549	C	A	Splice_Site		2
PNPT1	STAD	chr2	55900055	55900055	G	A	Missense_Mutation	p.S280L	2
PNPT1	PAAD	chr2	55874502	55874502	G	A	Missense_Mutation		2
PNPT1	HNSC	chr2	55894127	55894127	T	A	Splice_Site	p.Q392_splice	2
PNPT1	SARC	chr2	55887311	55887311	T	C	Missense_Mutation	p.N422S	2
PNPT1	STAD	chr2	55920812	55920812	C	G	Silent	p.V49V	2
PNPT1	SARC	chr2	55882064	55882064	C	-	Frame_Shift_Del	p.C489fs	2
PNPT1	STAD	chr2	55870530	55870530	G	A	Missense_Mutation	p.T646M	2
PNPT1	LIHC	chr2	55910944	55910944	T	A	Silent		2
PNPT1	UCEC	chr2	55871819	55871819	A	C	Missense_Mutation	p.F620C	2
PNPT1	BRCA	chr2	55870522	55870522	C	T	Missense_Mutation	p.V649I	2
PNPT1	HNSC	chr2	55894127	55894127	T	A	Missense_Mutation	p.Q392L	2
PNPT1	LUAD	chr2	55874559	55874559	C	G	Missense_Mutation	p.V509L	2
PNPT1	STAD	chr2	55907854	55907854	T	C	Silent	p.G186G	2
PNPT1	PCPG	chr2	55900135	55900135	T	C	Silent		2
PNPT1	UCEC	chr2	55872517	55872517	G	A	Nonsense_Mutation	p.R597*	2
PNPT1	SKCM	chr2	55887307	55887307	G	A	Silent	p.F423F	2
PNPT1	BRCA	chr2	55894154	55894154	G	A	Missense_Mutation	p.S383L	2
PNPT1	PCPG	chr2	55900135	55900135	T	C	Silent	p.Q253Q	2
PNPT1	UCEC	chr2	55883311	55883311	A	C	Missense_Mutation	p.F466V	2
PNPT1	SKCM	chr2	55912144	55912144	G	A	Missense_Mutation	p.P113S	2
PNPT1	BRCA	chr2	55920943	55920943	A	C	Missense_Mutation	p.Y6D	2
PNPT1	HNSC	chr2	55894167	55894167	T	-	Frame_Shift_Del	p.T379fs	2
PNPT1	HNSC	chr2	55874497	55874497	C	T	Silent	p.L529L	1
PNPT1	READ	chr2	55906921	55906921	C	T	Missense_Mutation	p.R192Q	1
PNPT1	LUAD	chr2	55894185	55894185	C	A	Nonsense_Mutation	p.E373*	1
PNPT1	SKCM	chr2	55894190	55894190	C	T	Missense_Mutation	p.S371N	1
PNPT1	KIRP	chr2	55863462	55863462	C	T	Silent	p.S754S	1
PNPT1	LUSC	chr2	55895077	55895077	G	C	Silent	p.A331A	1
PNPT1	BLCA	chr2	55920859	55920859	G	T	Missense_Mutation	p.Q34K	1
PNPT1	HNSC	chr2	55914784	55914784	A	G	Missense_Mutation	p.V73A	1
PNPT1	READ	chr2	55872499	55872499	T	G	Missense_Mutation	p.N603H	1
PNPT1	UCS	chr2	55872564	55872564	G	A	Missense_Mutation		1
PNPT1	SKCM	chr2	55907865	55907865	G	A	Missense_Mutation	p.P183S	1
PNPT1	CESC	chr2	55906874	55906874	C	A	Nonsense_Mutation		1
PNPT1	LGG	chr2	55873622	55873622	C	A	Splice_Site		1
PNPT1	LUSC	chr2	55920888	55920888	G	T	Missense_Mutation	p.P24Q	1
PNPT1	THCA	chr2	55907895	55907895	C	A	Splice_Site		1
PNPT1	BLCA	chr2	55908017	55908017	C	T	Missense_Mutation		1
PNPT1	BLCA	chr2	55908017	55908017	C	T	Missense_Mutation	p.E164K	1
PNPT1	READ	chr2	55906867	55906867	G	T	Missense_Mutation	p.S210Y	1
PNPT1	LUAD	chr2	55912159	55912159	C	A	Missense_Mutation	p.A108S	1
PNPT1	SKCM	chr2	55913524	55913524	G	A	Missense_Mutation	p.S93F	1
PNPT1	CESC	chr2	55883471	55883471	G	A	Silent	p.V440	1
PNPT1	LIHC	chr2	55872538	55872538	T	C	Missense_Mutation		1
PNPT1	LUSC	chr2	55870350	55870350	T	A	Splice_Site	p.Q672_splice	1
PNPT1	THYM	chr2	55913527	55913527	G	T	Missense_Mutation		1
PNPT1	BLCA	chr2	55920907	55920907	C	T	Missense_Mutation		1
PNPT1	GBM	chr2	55874482	55874482	C	G	Missense_Mutation	p.L534_splice	1
PNPT1	BLCA	chr2	55920907	55920907	C	T	Missense_Mutation	p.D18N	1
PNPT1	HNSC	chr2	55873415	55873415	C	G	Missense_Mutation	p.E573Q	1
PNPT1	LIHC	chr2	55873424	55873424	T	-	Frame_Shift_Del	p.I570fs	1
PNPT1	SARC	chr2	55863457	55863457	G	T	Missense_Mutation		1
PNPT1	BLCA	chr2	55898469	55898469	C	T	Missense_Mutation		1
PNPT1	CHOL	chr2	55874589	55874589	C	A	Splice_Site		1
PNPT1	LIHC	chr2	55889160	55889160	A	G	Missense_Mutation		1
PNPT1	LUSC	chr2	55899142	55899142	G	A	Silent	p.Y302Y	1
PNPT1	HNSC	chr2	55900087	55900087	G	C	Silent		1
PNPT1	BLCA	chr2	55870295	55870295	G	A	Silent	p.I689I	1
PNPT1	HNSC	chr2	55920943	55920943	A	G	Missense_Mutation	p.Y6H	1
PNPT1	LUAD	chr2	55908017	55908017	C	A	Nonsense_Mutation	p.E164*	1
PNPT1	BLCA	chr2	55883275	55883275	C	G	Missense_Mutation		1
PNPT1	LIHC	chr2	55908051	55908051	A	G	Silent		1
PNPT1	BLCA	chr2	55870295	55870295	G	A	Silent		1
PNPT1	HNSC	chr2	55895069	55895069	T	G	Missense_Mutation		1
PNPT1	BLCA	chr2	55863489	55863489	C	G	Missense_Mutation	p.M745I	1
PNPT1	HNSC	chr2	55900074	55900074	G	A	Nonsense_Mutation	p.Q274*	1
PNPT1	LIHC	chr2	55887319	55887319	T	-	Frame_Shift_Del	p.K419fs	1
PNPT1	SARC	chr2	55882064	55882064	C	-	Frame_Shift_Del		1
PNPT1	KIRP	chr2	55863466	55863466	T	C	Missense_Mutation	p.Q753R	1
PNPT1	BLCA	chr2	55874511	55874511	C	T	Missense_Mutation		1
PNPT1	COAD	chr2	55867798	55867798	C	T	Silent	p.A704A	1
PNPT1	LIHC	chr2	55906857	55906857	A	G	Silent		1
PNPT1	UCEC	chr2	55895034	55895034	C	A	Nonsense_Mutation	p.E346*	1
PNPT1	BLCA	chr2	55863489	55863489	C	G	Missense_Mutation		1
PNPT1	HNSC	chr2	55870313	55870313	G	T	Silent		1
PNPT1	LIHC	chr2	55900170	55900170	A	-	Frame_Shift_Del	p.C242fs	1
PNPT1	LUAD	chr2	55895085	55895085	G	C	Missense_Mutation	p.P329A	1
PNPT1	BLCA	chr2	55895089	55895089	T	-	Frame_Shift_Del		1
PNPT1	COAD	chr2	55873414	55873414	T	C	Missense_Mutation	p.E573G	1
PNPT1	LIHC	chr2	55872485	55872485	T	C	Silent		1
PNPT1	BLCA	chr2	55898469	55898469	C	T	Missense_Mutation	p.E321K	1
PNPT1	HNSC	chr2	55920943	55920943	A	G	Missense_Mutation		1
PNPT1	BLCA	chr2	55882034	55882034	C	T	Splice_Site	p.G499_splice	1
PNPT1	HNSC	chr2	55900087	55900087	G	C	Silent	p.T269T	1
PNPT1	LIHC	chr2	55895026	55895026	A	-	Frame_Shift_Del	p.F348fs	1
PNPT1	KIRP	chr2	55870498	55870498	T	C	Missense_Mutation	p.M657V	1
PNPT1	LUAD	chr2	55895050	55895050	G	C	Missense_Mutation	p.F340L	1
PNPT1	BLCA	chr2	55895071	55895071	T	C	Silent		1
PNPT1	COAD	chr2	55898471	55898471	G	A	Missense_Mutation	p.T320M	1
PNPT1	BLCA	chr2	55883275	55883275	C	G	Missense_Mutation	p.E478Q	1
PNPT1	HNSC	chr2	55914784	55914784	A	G	Missense_Mutation		1
PNPT1	LIHC	chr2	55872558	55872558	T	-	Frame_Shift_Del	p.K583fs	1
PNPT1	SARC	chr2	55870339	55870339	G	T	Missense_Mutation		1
PNPT1	KIRP	chr2	55900032	55900032	G	C	Missense_Mutation	p.H288D	1
PNPT1	BLCA	chr2	55895095	55895095	T	G	Splice_Site		1
PNPT1	COAD	chr2	55900197	55900197	C	T	Missense_Mutation	p.A233T	1
PNPT1	HNSC	chr2	55873415	55873415	C	G	Missense_Mutation		1
PNPT1	LIHC	chr2	55906857	55906857	A	G	Silent	p.T213T	1
PNPT1	BLCA	chr2	55874511	55874511	C	T	Missense_Mutation	p.E525K	1
PNPT1	HNSC	chr2	55894995	55894995	A	G	Splice_Site	p.R358_splice	1
PNPT1	LIHC	chr2	55883317	55883317	G	-	Frame_Shift_Del	p.R464fs	1
PNPT1	KIRP	chr2	55900121	55900121	C	T	Missense_Mutation	p.G258D	1
PNPT1	LUAD	chr2	55867787	55867787	T	C	Missense_Mutation	p.H708R	1
PNPT1	STAD	chr2	55874501	55874501	C	T	Missense_Mutation	p.R528H	1
PNPT1	BLCA	chr2	55900125	55900125	G	T	Missense_Mutation		1
PNPT1	COAD	chr2	55906912	55906912	A	T	Missense_Mutation	p.I195K	1
PNPT1	HNSC	chr2	55874497	55874497	C	T	Silent		1
PNPT1	LIHC	chr2	55871841	55871846	GAACCT	-	In_Frame_Del	p.611_613del	1
PNPT1	LUAD	chr2	55920933	55920933	G	C	Missense_Mutation	p.S9W	1
PNPT1	SKCM	chr2	55913551	55913551	G	A	Missense_Mutation	p.A84V	1
PNPT1	KIRP	chr2	55908004	55908004	A	G	Missense_Mutation		1
PNPT1	LUAD	chr2	55921012	55921012	A	T	Splice_Site		1
PNPT1	STAD	chr2	55908054	55908054	C	A	Splice_Site	p.V152_splice	1
PNPT1	BLCA	chr2	55920859	55920859	G	T	Missense_Mutation		1
PNPT1	COAD	chr2	55867766	55867766	C	T	Missense_Mutation	p.R715Q	1

Copy number variation (CNV) of PNPT1
* Click on the image to open the original image in a new window.

Fusion gene breakpoints (product of the structural variants (SVs)) across PNPT1
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion genes with this translation factor from FusionGDB2.0.

FusionGDB2 ID	Disease	Sample	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand
84055	N/A	CS190193	HSP90AA1	chr14	102551711	+	PNPT1	chr2	55906862	-
86765	N/A	BF895069	PNPT1	chr2	55899697	-	ASAP1	chr8	131065683	+
100354	STAD	TCGA-D7-A6F2	PNPT1	chr2	55910919	-	FBXO11	chr2	48050499	-
84055	N/A	BI025641	PNPT1	chr2	55898480	-	PNPT1	chr2	55894144	+
84055	N/A	BQ378709	PNPT1	chr2	55894211	+	PNPT1	chr2	55873579	+
84056	LIHC	TCGA-UB-A7MB-01A	SMEK2	chr2	55831114	-	PNPT1	chr2	55864734	-

Top

Prognostic Analysis

Kaplan-Meier plots with logrank tests of overall survival (OS)

Cancer type

Translation factor

Coefficent

Hazard ratio

Wald test pval

Likelihool ratio pval

Logrank test pval

# samples

Top

Translation factor and Gender

Differential gene expression between female and male. (Wilcoxon test, pval<0.05)

Cancer type	Translation factor	pval	adj.p
LUAD	PNPT1	0.000325316908494329	0.0088
LUSC	PNPT1	0.0116681303543322	0.3
KIRC	PNPT1	0.0128867296072515	0.32
GBM	PNPT1	0.0266263430559731	0.64
KIRP	PNPT1	0.0332164779217466	0.76
TGCT	PNPT1	2.44298208510894e-05	0.00068

Top

Translation factor and Age

Differential gene expression between young and old age groups (Wilcoxon test, pval<0.05)

Cancer type	Translation factor	pval	adj.p
STAD	PNPT1	0.020991766011156	0.63
KIRC	PNPT1	0.00218349112160951	0.072
BRCA	PNPT1	0.00928947499372885	0.29
PAAD	PNPT1	0.00425016002710594	0.14
ESCA	PNPT1	0.0316600278246185	0.92

Top

Related Drugs

Drugs targeting genes involved in this translation factor.
(DrugBank Version 5.1.8 2021-05-08)

UniProtAcc

DrugBank ID

Drug name

Drug activity

Drug type

Drug status

Top

Related Diseases

Diseases associated with this translation factor.
(DisGeNet 4.0)

Disease ID	Disease Name	# PubMeds	Disease source
C1824925	DEAFNESS, AUTOSOMAL RECESSIVE 70	4	CTD_human;GENOMICS_ENGLAND;UNIPROT
C3554129	COMBINED OXIDATIVE PHOSPHORYLATION DEFICIENCY 13	4	CTD_human;GENOMICS_ENGLAND;ORPHANET;UNIPROT
C0557874	Global developmental delay	1	GENOMICS_ENGLAND
C1846647	DEAFNESS, AUTOSOMAL RECESSIVE (disorder)	1	CLINGEN
C2239176	Liver carcinoma	1	CTD_human