|
Fusion Protein:EXOSC4-NEIL2 |
Fusion Gene and Fusion Protein Summary |
Fusion gene summary |
Fusion partner gene information | Fusion gene name: EXOSC4-NEIL2 | FusionPDB ID: 27981 | FusionGDB2.0 ID: 27981 | Hgene | Tgene | Gene symbol | EXOSC4 | NEIL2 | Gene ID | 54512 | 252969 |
Gene name | exosome component 4 | nei like DNA glycosylase 2 | |
Synonyms | RRP41|RRP41A|Rrp41p|SKI6|Ski6p|hRrp41p|p12A | NEH2|NEI2 | |
Cytomap | 8q24.3 | 8p23.1 | |
Type of gene | protein-coding | protein-coding | |
Description | exosome complex component RRP41exosome complex exonuclease RRP41exosome component Rrp41ribosomal RNA-processing protein 41 | endonuclease 8-like 2DNA glycosylase/AP lyase Neil2DNA-(apurinic or apyrimidinic site) lyase Neil2nei endonuclease VIII-like 2nei homolog 2nei-like protein 2 | |
Modification date | 20200313 | 20200313 | |
UniProtAcc | Q9NPD3 Main function of 5'-partner protein: FUNCTION: Non-catalytic component of the RNA exosome complex which has 3'->5' exoribonuclease activity and participates in a multitude of cellular RNA processing and degradation events. In the nucleus, the RNA exosome complex is involved in proper maturation of stable RNA species such as rRNA, snRNA and snoRNA, in the elimination of RNA processing by-products and non-coding 'pervasive' transcripts, such as antisense RNA species and promoter-upstream transcripts (PROMPTs), and of mRNAs with processing defects, thereby limiting or excluding their export to the cytoplasm. The RNA exosome may be involved in Ig class switch recombination (CSR) and/or Ig variable region somatic hypermutation (SHM) by targeting AICDA deamination activity to transcribed dsDNA substrates. In the cytoplasm, the RNA exosome complex is involved in general mRNA turnover and specifically degrades inherently unstable mRNAs containing AU-rich elements (AREs) within their 3' untranslated regions, and in RNA surveillance pathways, preventing translation of aberrant mRNAs. It seems to be involved in degradation of histone mRNA. The catalytic inactive RNA exosome core complex of 9 subunits (Exo-9) is proposed to play a pivotal role in the binding and presentation of RNA for ribonucleolysis, and to serve as a scaffold for the association with catalytic subunits and accessory proteins or complexes. EXOSC4 binds to ARE-containing RNAs. {ECO:0000269|PubMed:16912217, ECO:0000269|PubMed:17545563, ECO:0000269|PubMed:18172165, ECO:0000269|PubMed:20368444, ECO:0000269|PubMed:21255825}. | Q969S2 Main function of 5'-partner protein: FUNCTION: Involved in base excision repair of DNA damaged by oxidation or by mutagenic agents. Has DNA glycosylase activity towards 5-hydroxyuracil and other oxidized derivatives of cytosine with a preference for mismatched double-stranded DNA (DNA bubbles). Has low or no DNA glycosylase activity towards thymine glycol, 2-hydroxyadenine, hypoxanthine and 8-oxoguanine. Has AP (apurinic/apyrimidinic) lyase activity and introduces nicks in the DNA strand. Cleaves the DNA backbone by beta-delta elimination to generate a single-strand break at the site of the removed base with both 3'- and 5'-phosphates. {ECO:0000269|PubMed:12097317, ECO:0000269|PubMed:14522990, ECO:0000269|PubMed:15175427, ECO:0000269|PubMed:15339932}. | |
Ensembl transtripts involved in fusion gene | ENST ids | ENST00000316052, ENST00000525936, | ENST00000403422, ENST00000284503, ENST00000528323, ENST00000436750, ENST00000455213, |
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0) | * DoF score | 2 X 4 X 2=16 | 2 X 6 X 3=36 |
# samples | 3 | 4 | |
** MAII score | log2(3/16*10)=0.906890595608518 effective Gene in Pan-Cancer Fusion Genes (eGinPCFGs). DoF>8 and MAII>0 | log2(4/36*10)=0.15200309344505 effective Gene in Pan-Cancer Fusion Genes (eGinPCFGs). DoF>8 and MAII>0 | |
Fusion gene context | PubMed: EXOSC4 [Title/Abstract] AND NEIL2 [Title/Abstract] AND fusion [Title/Abstract] | ||
Fusion neoantigen context | PubMed: EXOSC4 [Title/Abstract] AND NEIL2 [Title/Abstract] AND neoantigen [Title/Abstract] | ||
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0) | EXOSC4(145133803)-NEIL2(11637108), # samples:1 EXOSC4(145133802)-NEIL2(11637106), # samples:1 EXOSC4(145133800)-NEIL2(11637105), # samples:1 EXOSC4(145133802)-NEIL2(11637107), # samples:1 | ||
Anticipated loss of major functional domain due to fusion event. | EXOSC4-NEIL2 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. EXOSC4-NEIL2 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. |
* DoF score (Degree of Frequency) = # partners X # break points X # cancer types ** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10) |
Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez |
Partner | Gene | GO ID | GO term | PubMed ID |
Hgene | EXOSC4 | GO:0045006 | DNA deamination | 21255825 |
Four levels of functional features of fusion genes Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr8:145133803/chr8:11637108) - FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels. - How to search 1. Put your fusion gene symbol. 2. Press the tab key until there will be shown the breakpoint information filled. 4. Go down and press 'Search' tab twice. 4. Go down to have the hyperlink of the search result. 5. Click the hyperlink. 6. See the FGviewer result for your fusion gene. |
Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here. |
Fusion gene breakpoints across EXOSC4 (5'-gene) * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
Fusion gene breakpoints across NEIL2 (3'-gene) * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
Top |
Fusion Amino Acid Sequences |
Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB. |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | Seq length (transcript) | BP loci (transcript) | Predicted start (transcript) | Predicted stop (transcript) | Seq length (amino acids) |
ENST00000316052 | EXOSC4 | chr8 | 145133803 | + | ENST00000436750 | NEIL2 | chr8 | 11637108 | + | 2207 | 274 | 103 | 1134 | 343 |
ENST00000316052 | EXOSC4 | chr8 | 145133803 | + | ENST00000455213 | NEIL2 | chr8 | 11637108 | + | 2202 | 274 | 103 | 1134 | 343 |
ENST00000525936 | EXOSC4 | chr8 | 145133803 | + | ENST00000436750 | NEIL2 | chr8 | 11637108 | + | 2185 | 252 | 81 | 1112 | 343 |
ENST00000525936 | EXOSC4 | chr8 | 145133803 | + | ENST00000455213 | NEIL2 | chr8 | 11637108 | + | 2180 | 252 | 81 | 1112 | 343 |
ENST00000316052 | EXOSC4 | chr8 | 145133802 | + | ENST00000436750 | NEIL2 | chr8 | 11637106 | + | 2207 | 274 | 103 | 1134 | 343 |
ENST00000316052 | EXOSC4 | chr8 | 145133802 | + | ENST00000455213 | NEIL2 | chr8 | 11637106 | + | 2202 | 274 | 103 | 1134 | 343 |
ENST00000525936 | EXOSC4 | chr8 | 145133802 | + | ENST00000436750 | NEIL2 | chr8 | 11637106 | + | 2185 | 252 | 81 | 1112 | 343 |
ENST00000525936 | EXOSC4 | chr8 | 145133802 | + | ENST00000455213 | NEIL2 | chr8 | 11637106 | + | 2180 | 252 | 81 | 1112 | 343 |
ENST00000316052 | EXOSC4 | chr8 | 145133800 | + | ENST00000436750 | NEIL2 | chr8 | 11637105 | + | 2207 | 274 | 103 | 1134 | 343 |
ENST00000316052 | EXOSC4 | chr8 | 145133800 | + | ENST00000455213 | NEIL2 | chr8 | 11637105 | + | 2202 | 274 | 103 | 1134 | 343 |
ENST00000525936 | EXOSC4 | chr8 | 145133800 | + | ENST00000436750 | NEIL2 | chr8 | 11637105 | + | 2185 | 252 | 81 | 1112 | 343 |
ENST00000525936 | EXOSC4 | chr8 | 145133800 | + | ENST00000455213 | NEIL2 | chr8 | 11637105 | + | 2180 | 252 | 81 | 1112 | 343 |
ENST00000316052 | EXOSC4 | chr8 | 145133802 | - | ENST00000436750 | NEIL2 | chr8 | 11637107 | + | 2207 | 274 | 103 | 1134 | 343 |
ENST00000316052 | EXOSC4 | chr8 | 145133802 | - | ENST00000455213 | NEIL2 | chr8 | 11637107 | + | 2202 | 274 | 103 | 1134 | 343 |
ENST00000525936 | EXOSC4 | chr8 | 145133802 | - | ENST00000436750 | NEIL2 | chr8 | 11637107 | + | 2185 | 252 | 81 | 1112 | 343 |
ENST00000525936 | EXOSC4 | chr8 | 145133802 | - | ENST00000455213 | NEIL2 | chr8 | 11637107 | + | 2180 | 252 | 81 | 1112 | 343 |
DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated. |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | No-coding score | Coding score |
ENST00000316052 | ENST00000436750 | EXOSC4 | chr8 | 145133803 | + | NEIL2 | chr8 | 11637108 | + | 0.006514239 | 0.99348575 |
ENST00000316052 | ENST00000455213 | EXOSC4 | chr8 | 145133803 | + | NEIL2 | chr8 | 11637108 | + | 0.006525775 | 0.9934742 |
ENST00000525936 | ENST00000436750 | EXOSC4 | chr8 | 145133803 | + | NEIL2 | chr8 | 11637108 | + | 0.006518771 | 0.9934813 |
ENST00000525936 | ENST00000455213 | EXOSC4 | chr8 | 145133803 | + | NEIL2 | chr8 | 11637108 | + | 0.006491744 | 0.9935082 |
ENST00000316052 | ENST00000436750 | EXOSC4 | chr8 | 145133802 | + | NEIL2 | chr8 | 11637106 | + | 0.006514239 | 0.99348575 |
ENST00000316052 | ENST00000455213 | EXOSC4 | chr8 | 145133802 | + | NEIL2 | chr8 | 11637106 | + | 0.006525775 | 0.9934742 |
ENST00000525936 | ENST00000436750 | EXOSC4 | chr8 | 145133802 | + | NEIL2 | chr8 | 11637106 | + | 0.006518771 | 0.9934813 |
ENST00000525936 | ENST00000455213 | EXOSC4 | chr8 | 145133802 | + | NEIL2 | chr8 | 11637106 | + | 0.006491744 | 0.9935082 |
ENST00000316052 | ENST00000436750 | EXOSC4 | chr8 | 145133800 | + | NEIL2 | chr8 | 11637105 | + | 0.006514239 | 0.99348575 |
ENST00000316052 | ENST00000455213 | EXOSC4 | chr8 | 145133800 | + | NEIL2 | chr8 | 11637105 | + | 0.006525775 | 0.9934742 |
ENST00000525936 | ENST00000436750 | EXOSC4 | chr8 | 145133800 | + | NEIL2 | chr8 | 11637105 | + | 0.006518771 | 0.9934813 |
ENST00000525936 | ENST00000455213 | EXOSC4 | chr8 | 145133800 | + | NEIL2 | chr8 | 11637105 | + | 0.006491744 | 0.9935082 |
ENST00000316052 | ENST00000436750 | EXOSC4 | chr8 | 145133802 | - | NEIL2 | chr8 | 11637107 | + | 0.006514239 | 0.99348575 |
ENST00000316052 | ENST00000455213 | EXOSC4 | chr8 | 145133802 | - | NEIL2 | chr8 | 11637107 | + | 0.006525775 | 0.9934742 |
ENST00000525936 | ENST00000436750 | EXOSC4 | chr8 | 145133802 | - | NEIL2 | chr8 | 11637107 | + | 0.006518771 | 0.9934813 |
ENST00000525936 | ENST00000455213 | EXOSC4 | chr8 | 145133802 | - | NEIL2 | chr8 | 11637107 | + | 0.006491744 | 0.9935082 |
Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones. |
Get the fusion protein sequences from here. |
Fusion protein sequence information is available in the fasta format. >FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP |
Top |
Fusion Protein Breakpoint Sequences for EXOSC4-NEIL2 |
+/-13 AA sequence from the breakpoints of the fusion protein sequences. |
Hgene | Hchr | Hbp | Tgene | Tchr | Tbp | Length(fusion protein) | BP in fusion protein | Peptide |
EXOSC4 | chr8 | 145133800 | NEIL2 | chr8 | 11637105 | 252 | 57 | NTKALAVVYGPHEVHGKKLFLRFDLD |
EXOSC4 | chr8 | 145133800 | NEIL2 | chr8 | 11637105 | 274 | 57 | NTKALAVVYGPHEVHGKKLFLRFDLD |
EXOSC4 | chr8 | 145133802 | NEIL2 | chr8 | 11637106 | 252 | 57 | NTKALAVVYGPHEVHGKKLFLRFDLD |
EXOSC4 | chr8 | 145133802 | NEIL2 | chr8 | 11637106 | 274 | 57 | NTKALAVVYGPHEVHGKKLFLRFDLD |
EXOSC4 | chr8 | 145133802 | NEIL2 | chr8 | 11637107 | 252 | 57 | NTKALAVVYGPHEVHGKKLFLRFDLD |
EXOSC4 | chr8 | 145133802 | NEIL2 | chr8 | 11637107 | 274 | 57 | NTKALAVVYGPHEVHGKKLFLRFDLD |
EXOSC4 | chr8 | 145133803 | NEIL2 | chr8 | 11637108 | 252 | 57 | NTKALAVVYGPHEVHGKKLFLRFDLD |
EXOSC4 | chr8 | 145133803 | NEIL2 | chr8 | 11637108 | 274 | 57 | NTKALAVVYGPHEVHGKKLFLRFDLD |
Top |
Potential FusionNeoAntigen Information of EXOSC4-NEIL2 in HLA I |
Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific. |
EXOSC4-NEIL2_145133800_11637105.msa |
Potential FusionNeoAntigen Information * We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5) |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA I | FusionNeoAntigen peptide | Binding score | Immunogenic score | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
EXOSC4-NEIL2 | chr8 | 145133800 | chr8 | 11637105 | 274 | HLA-B52:01 | VVYGPHEV | 0.9968 | 0.9963 | 6 | 14 |
EXOSC4-NEIL2 | chr8 | 145133800 | chr8 | 11637105 | 274 | HLA-A66:01 | EVHGKKLFL | 0.9919 | 0.6609 | 12 | 21 |
EXOSC4-NEIL2 | chr8 | 145133800 | chr8 | 11637105 | 274 | HLA-A26:03 | EVHGKKLFL | 0.985 | 0.619 | 12 | 21 |
EXOSC4-NEIL2 | chr8 | 145133800 | chr8 | 11637105 | 274 | HLA-B18:01 | HEVHGKKLF | 0.9739 | 0.8345 | 11 | 20 |
EXOSC4-NEIL2 | chr8 | 145133800 | chr8 | 11637105 | 274 | HLA-B44:03 | HEVHGKKLF | 0.9692 | 0.9589 | 11 | 20 |
EXOSC4-NEIL2 | chr8 | 145133800 | chr8 | 11637105 | 274 | HLA-A02:38 | AVVYGPHEV | 0.9601 | 0.79 | 5 | 14 |
EXOSC4-NEIL2 | chr8 | 145133800 | chr8 | 11637105 | 274 | HLA-A26:15 | EVHGKKLFL | 0.959 | 0.5754 | 12 | 21 |
EXOSC4-NEIL2 | chr8 | 145133800 | chr8 | 11637105 | 274 | HLA-A26:14 | EVHGKKLFL | 0.959 | 0.5754 | 12 | 21 |
EXOSC4-NEIL2 | chr8 | 145133800 | chr8 | 11637105 | 274 | HLA-A02:21 | AVVYGPHEV | 0.9344 | 0.7439 | 5 | 14 |
EXOSC4-NEIL2 | chr8 | 145133800 | chr8 | 11637105 | 274 | HLA-A02:29 | AVVYGPHEV | 0.9254 | 0.6372 | 5 | 14 |
EXOSC4-NEIL2 | chr8 | 145133800 | chr8 | 11637105 | 274 | HLA-A02:35 | AVVYGPHEV | 0.9163 | 0.663 | 5 | 14 |
EXOSC4-NEIL2 | chr8 | 145133800 | chr8 | 11637105 | 274 | HLA-A02:20 | AVVYGPHEV | 0.9157 | 0.6441 | 5 | 14 |
EXOSC4-NEIL2 | chr8 | 145133800 | chr8 | 11637105 | 274 | HLA-A02:60 | AVVYGPHEV | 0.9037 | 0.6329 | 5 | 14 |
EXOSC4-NEIL2 | chr8 | 145133800 | chr8 | 11637105 | 274 | HLA-A02:24 | AVVYGPHEV | 0.9017 | 0.6367 | 5 | 14 |
EXOSC4-NEIL2 | chr8 | 145133800 | chr8 | 11637105 | 274 | HLA-A02:30 | AVVYGPHEV | 0.9017 | 0.6367 | 5 | 14 |
EXOSC4-NEIL2 | chr8 | 145133800 | chr8 | 11637105 | 274 | HLA-A02:67 | AVVYGPHEV | 0.9017 | 0.6367 | 5 | 14 |
EXOSC4-NEIL2 | chr8 | 145133800 | chr8 | 11637105 | 274 | HLA-B08:01 | EVHGKKLFL | 0.8974 | 0.6993 | 12 | 21 |
EXOSC4-NEIL2 | chr8 | 145133800 | chr8 | 11637105 | 274 | HLA-A02:11 | AVVYGPHEV | 0.8954 | 0.6555 | 5 | 14 |
EXOSC4-NEIL2 | chr8 | 145133800 | chr8 | 11637105 | 274 | HLA-A02:22 | AVVYGPHEV | 0.8753 | 0.57 | 5 | 14 |
EXOSC4-NEIL2 | chr8 | 145133800 | chr8 | 11637105 | 274 | HLA-A02:16 | AVVYGPHEV | 0.8412 | 0.5777 | 5 | 14 |
EXOSC4-NEIL2 | chr8 | 145133800 | chr8 | 11637105 | 274 | HLA-A02:13 | AVVYGPHEV | 0.8396 | 0.828 | 5 | 14 |
EXOSC4-NEIL2 | chr8 | 145133800 | chr8 | 11637105 | 274 | HLA-B08:09 | EVHGKKLFL | 0.8251 | 0.6805 | 12 | 21 |
EXOSC4-NEIL2 | chr8 | 145133800 | chr8 | 11637105 | 274 | HLA-A02:27 | AVVYGPHEV | 0.8147 | 0.6618 | 5 | 14 |
EXOSC4-NEIL2 | chr8 | 145133800 | chr8 | 11637105 | 274 | HLA-B13:02 | AVVYGPHEV | 0.5497 | 0.9881 | 5 | 14 |
EXOSC4-NEIL2 | chr8 | 145133800 | chr8 | 11637105 | 274 | HLA-B07:05 | GPHEVHGKKL | 0.9929 | 0.5398 | 9 | 19 |
EXOSC4-NEIL2 | chr8 | 145133800 | chr8 | 11637105 | 274 | HLA-B81:01 | GPHEVHGKKL | 0.3483 | 0.5845 | 9 | 19 |
EXOSC4-NEIL2 | chr8 | 145133800 | chr8 | 11637105 | 274 | HLA-B82:01 | GPHEVHGKKL | 0.1728 | 0.5126 | 9 | 19 |
EXOSC4-NEIL2 | chr8 | 145133800 | chr8 | 11637105 | 274 | HLA-A30:08 | VVYGPHEVHGK | 0.9972 | 0.6364 | 6 | 17 |
EXOSC4-NEIL2 | chr8 | 145133800 | chr8 | 11637105 | 274 | HLA-A02:22 | ALAVVYGPHEV | 0.9963 | 0.672 | 3 | 14 |
EXOSC4-NEIL2 | chr8 | 145133800 | chr8 | 11637105 | 274 | HLA-A02:27 | ALAVVYGPHEV | 0.9959 | 0.7733 | 3 | 14 |
EXOSC4-NEIL2 | chr8 | 145133800 | chr8 | 11637105 | 274 | HLA-A02:13 | ALAVVYGPHEV | 0.9957 | 0.8541 | 3 | 14 |
EXOSC4-NEIL2 | chr8 | 145133800 | chr8 | 11637105 | 274 | HLA-A02:19 | ALAVVYGPHEV | 0.9612 | 0.6151 | 3 | 14 |
EXOSC4-NEIL2 | chr8 | 145133800 | chr8 | 11637105 | 274 | HLA-B44:03 | GPHEVHGKKLF | 0.7425 | 0.9724 | 9 | 20 |
EXOSC4-NEIL2 | chr8 | 145133800 | chr8 | 11637105 | 274 | HLA-C15:06 | VVYGPHEV | 0.9996 | 0.956 | 6 | 14 |
EXOSC4-NEIL2 | chr8 | 145133800 | chr8 | 11637105 | 274 | HLA-C04:06 | VVYGPHEV | 0.9996 | 0.9923 | 6 | 14 |
EXOSC4-NEIL2 | chr8 | 145133800 | chr8 | 11637105 | 274 | HLA-B51:07 | VVYGPHEV | 0.9973 | 0.9914 | 6 | 14 |
EXOSC4-NEIL2 | chr8 | 145133800 | chr8 | 11637105 | 274 | HLA-C06:03 | VVYGPHEV | 0.9969 | 0.9953 | 6 | 14 |
EXOSC4-NEIL2 | chr8 | 145133800 | chr8 | 11637105 | 274 | HLA-C12:04 | VVYGPHEV | 0.9962 | 0.9955 | 6 | 14 |
EXOSC4-NEIL2 | chr8 | 145133800 | chr8 | 11637105 | 274 | HLA-C15:06 | AVVYGPHEV | 0.9954 | 0.9543 | 5 | 14 |
EXOSC4-NEIL2 | chr8 | 145133800 | chr8 | 11637105 | 274 | HLA-A26:01 | EVHGKKLFL | 0.959 | 0.5754 | 12 | 21 |
EXOSC4-NEIL2 | chr8 | 145133800 | chr8 | 11637105 | 274 | HLA-C12:04 | AVVYGPHEV | 0.9512 | 0.9952 | 5 | 14 |
EXOSC4-NEIL2 | chr8 | 145133800 | chr8 | 11637105 | 274 | HLA-C06:03 | AVVYGPHEV | 0.9463 | 0.9956 | 5 | 14 |
EXOSC4-NEIL2 | chr8 | 145133800 | chr8 | 11637105 | 274 | HLA-A02:01 | AVVYGPHEV | 0.9017 | 0.6367 | 5 | 14 |
EXOSC4-NEIL2 | chr8 | 145133800 | chr8 | 11637105 | 274 | HLA-C02:06 | AVVYGPHEV | 0.8677 | 0.9896 | 5 | 14 |
EXOSC4-NEIL2 | chr8 | 145133800 | chr8 | 11637105 | 274 | HLA-B15:04 | VVYGPHEVH | 0.8019 | 0.9706 | 6 | 15 |
EXOSC4-NEIL2 | chr8 | 145133800 | chr8 | 11637105 | 274 | HLA-B07:12 | GPHEVHGKKL | 0.9516 | 0.6771 | 9 | 19 |
EXOSC4-NEIL2 | chr8 | 145133800 | chr8 | 11637105 | 274 | HLA-B42:02 | GPHEVHGKKL | 0.4363 | 0.8749 | 9 | 19 |
EXOSC4-NEIL2 | chr8 | 145133800 | chr8 | 11637105 | 274 | HLA-B42:01 | GPHEVHGKKL | 0.3943 | 0.8673 | 9 | 19 |
EXOSC4-NEIL2 | chr8 | 145133800 | chr8 | 11637105 | 274 | HLA-A02:02 | ALAVVYGPHEV | 0.9965 | 0.5382 | 3 | 14 |
EXOSC4-NEIL2 | chr8 | 145133800 | chr8 | 11637105 | 274 | HLA-C15:02 | VVYGPHEV | 0.9996 | 0.9756 | 6 | 14 |
EXOSC4-NEIL2 | chr8 | 145133800 | chr8 | 11637105 | 274 | HLA-C15:05 | VVYGPHEV | 0.9995 | 0.9848 | 6 | 14 |
EXOSC4-NEIL2 | chr8 | 145133800 | chr8 | 11637105 | 274 | HLA-B41:03 | HEVHGKKL | 0.912 | 0.632 | 11 | 19 |
EXOSC4-NEIL2 | chr8 | 145133800 | chr8 | 11637105 | 274 | HLA-C15:02 | AVVYGPHEV | 0.9982 | 0.9738 | 5 | 14 |
EXOSC4-NEIL2 | chr8 | 145133800 | chr8 | 11637105 | 274 | HLA-C15:05 | AVVYGPHEV | 0.9971 | 0.9816 | 5 | 14 |
EXOSC4-NEIL2 | chr8 | 145133800 | chr8 | 11637105 | 274 | HLA-A25:01 | EVHGKKLFL | 0.9836 | 0.9792 | 12 | 21 |
EXOSC4-NEIL2 | chr8 | 145133800 | chr8 | 11637105 | 274 | HLA-B18:07 | HEVHGKKLF | 0.9796 | 0.8114 | 11 | 20 |
EXOSC4-NEIL2 | chr8 | 145133800 | chr8 | 11637105 | 274 | HLA-B18:04 | HEVHGKKLF | 0.9769 | 0.8448 | 11 | 20 |
EXOSC4-NEIL2 | chr8 | 145133800 | chr8 | 11637105 | 274 | HLA-B18:08 | HEVHGKKLF | 0.9758 | 0.6078 | 11 | 20 |
EXOSC4-NEIL2 | chr8 | 145133800 | chr8 | 11637105 | 274 | HLA-B18:05 | HEVHGKKLF | 0.9739 | 0.8345 | 11 | 20 |
EXOSC4-NEIL2 | chr8 | 145133800 | chr8 | 11637105 | 274 | HLA-A68:02 | AVVYGPHEV | 0.9732 | 0.6413 | 5 | 14 |
EXOSC4-NEIL2 | chr8 | 145133800 | chr8 | 11637105 | 274 | HLA-B44:07 | HEVHGKKLF | 0.9692 | 0.9589 | 11 | 20 |
EXOSC4-NEIL2 | chr8 | 145133800 | chr8 | 11637105 | 274 | HLA-B44:13 | HEVHGKKLF | 0.9692 | 0.9589 | 11 | 20 |
EXOSC4-NEIL2 | chr8 | 145133800 | chr8 | 11637105 | 274 | HLA-B44:26 | HEVHGKKLF | 0.9692 | 0.9589 | 11 | 20 |
EXOSC4-NEIL2 | chr8 | 145133800 | chr8 | 11637105 | 274 | HLA-B18:06 | HEVHGKKLF | 0.9673 | 0.8395 | 11 | 20 |
EXOSC4-NEIL2 | chr8 | 145133800 | chr8 | 11637105 | 274 | HLA-B18:03 | HEVHGKKLF | 0.9629 | 0.829 | 11 | 20 |
EXOSC4-NEIL2 | chr8 | 145133800 | chr8 | 11637105 | 274 | HLA-A69:01 | AVVYGPHEV | 0.9405 | 0.8177 | 5 | 14 |
EXOSC4-NEIL2 | chr8 | 145133800 | chr8 | 11637105 | 274 | HLA-B40:04 | HEVHGKKLF | 0.9361 | 0.5961 | 11 | 20 |
EXOSC4-NEIL2 | chr8 | 145133800 | chr8 | 11637105 | 274 | HLA-A02:14 | AVVYGPHEV | 0.9351 | 0.6827 | 5 | 14 |
EXOSC4-NEIL2 | chr8 | 145133800 | chr8 | 11637105 | 274 | HLA-A02:06 | AVVYGPHEV | 0.9344 | 0.7439 | 5 | 14 |
EXOSC4-NEIL2 | chr8 | 145133800 | chr8 | 11637105 | 274 | HLA-A68:02 | EVHGKKLFL | 0.9148 | 0.5919 | 12 | 21 |
EXOSC4-NEIL2 | chr8 | 145133800 | chr8 | 11637105 | 274 | HLA-A02:03 | AVVYGPHEV | 0.9106 | 0.7633 | 5 | 14 |
EXOSC4-NEIL2 | chr8 | 145133800 | chr8 | 11637105 | 274 | HLA-B08:18 | EVHGKKLFL | 0.8974 | 0.6993 | 12 | 21 |
EXOSC4-NEIL2 | chr8 | 145133800 | chr8 | 11637105 | 274 | HLA-B18:11 | HEVHGKKLF | 0.8973 | 0.853 | 11 | 20 |
EXOSC4-NEIL2 | chr8 | 145133800 | chr8 | 11637105 | 274 | HLA-C12:02 | VVYGPHEVH | 0.7264 | 0.9545 | 6 | 15 |
EXOSC4-NEIL2 | chr8 | 145133800 | chr8 | 11637105 | 274 | HLA-A69:01 | EVHGKKLFL | 0.6942 | 0.68 | 12 | 21 |
EXOSC4-NEIL2 | chr8 | 145133800 | chr8 | 11637105 | 274 | HLA-B08:12 | EVHGKKLFL | 0.4585 | 0.8071 | 12 | 21 |
EXOSC4-NEIL2 | chr8 | 145133800 | chr8 | 11637105 | 274 | HLA-B41:03 | HEVHGKKLF | 0.2701 | 0.6101 | 11 | 20 |
EXOSC4-NEIL2 | chr8 | 145133800 | chr8 | 11637105 | 274 | HLA-B48:02 | HEVHGKKLF | 0.0942 | 0.8152 | 11 | 20 |
EXOSC4-NEIL2 | chr8 | 145133800 | chr8 | 11637105 | 274 | HLA-B15:53 | HEVHGKKLF | 0.0387 | 0.77 | 11 | 20 |
EXOSC4-NEIL2 | chr8 | 145133800 | chr8 | 11637105 | 274 | HLA-B15:54 | HEVHGKKLF | 0.0163 | 0.7423 | 11 | 20 |
EXOSC4-NEIL2 | chr8 | 145133800 | chr8 | 11637105 | 274 | HLA-B07:09 | GPHEVHGKKL | 0.9944 | 0.5049 | 9 | 19 |
EXOSC4-NEIL2 | chr8 | 145133800 | chr8 | 11637105 | 274 | HLA-B55:04 | GPHEVHGKKL | 0.3919 | 0.5814 | 9 | 19 |
EXOSC4-NEIL2 | chr8 | 145133800 | chr8 | 11637105 | 274 | HLA-B82:02 | GPHEVHGKKL | 0.1728 | 0.5126 | 9 | 19 |
EXOSC4-NEIL2 | chr8 | 145133800 | chr8 | 11637105 | 274 | HLA-A02:03 | ALAVVYGPHEV | 0.9984 | 0.8176 | 3 | 14 |
EXOSC4-NEIL2 | chr8 | 145133800 | chr8 | 11637105 | 274 | HLA-A25:01 | EVHGKKLFLRF | 0.9975 | 0.9544 | 12 | 23 |
EXOSC4-NEIL2 | chr8 | 145133800 | chr8 | 11637105 | 274 | HLA-A30:01 | VVYGPHEVHGK | 0.9967 | 0.6806 | 6 | 17 |
EXOSC4-NEIL2 | chr8 | 145133800 | chr8 | 11637105 | 274 | HLA-B44:07 | GPHEVHGKKLF | 0.7425 | 0.9724 | 9 | 20 |
EXOSC4-NEIL2 | chr8 | 145133800 | chr8 | 11637105 | 274 | HLA-B44:13 | GPHEVHGKKLF | 0.7425 | 0.9724 | 9 | 20 |
EXOSC4-NEIL2 | chr8 | 145133800 | chr8 | 11637105 | 274 | HLA-B44:26 | GPHEVHGKKLF | 0.7425 | 0.9724 | 9 | 20 |
Top |
Potential FusionNeoAntigen Information of EXOSC4-NEIL2 in HLA II |
Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific. |
Potential FusionNeoAntigen Information * We used NetMHCIIpan v4.1 (%rank<0.5). |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA II | FusionNeoAntigen peptide | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
Top |
Fusion breakpoint peptide structures of EXOSC4-NEIL2 |
3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens * The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA. |
File name | BPseq | Hgene | Tgene | Hchr | Hbp | Tchr | Tbp | AAlen |
10385 | VVYGPHEVHGKKLF | EXOSC4 | NEIL2 | chr8 | 145133800 | chr8 | 11637105 | 274 |
Top |
Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of EXOSC4-NEIL2 |
Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens * We used Glide to predict the interaction between HLAs and neoantigens. |
HLA allele | PDB ID | File name | BPseq | Docking score | Glide score |
HLA-B14:02 | 3BVN | 10385 | VVYGPHEVHGKKLF | -6.80686 | -6.92026 |
HLA-B14:02 | 3BVN | 10385 | VVYGPHEVHGKKLF | -5.01234 | -6.04764 |
HLA-B52:01 | 3W39 | 10385 | VVYGPHEVHGKKLF | -6.71251 | -6.82591 |
HLA-B52:01 | 3W39 | 10385 | VVYGPHEVHGKKLF | -4.13165 | -5.16695 |
HLA-A11:01 | 4UQ2 | 10385 | VVYGPHEVHGKKLF | -4.31699 | -4.43039 |
HLA-A11:01 | 4UQ2 | 10385 | VVYGPHEVHGKKLF | -4.19959 | -5.23489 |
HLA-A24:02 | 5HGA | 10385 | VVYGPHEVHGKKLF | -7.74913 | -7.86253 |
HLA-A24:02 | 5HGA | 10385 | VVYGPHEVHGKKLF | -5.75888 | -6.79418 |
HLA-B27:03 | 6PZ5 | 10385 | VVYGPHEVHGKKLF | 10001 | 10000 |
HLA-B44:05 | 3DX8 | 10385 | VVYGPHEVHGKKLF | -4.89721 | -5.01061 |
HLA-B44:05 | 3DX8 | 10385 | VVYGPHEVHGKKLF | -3.74482 | -4.78012 |
HLA-B35:01 | 1A1N | 10385 | VVYGPHEVHGKKLF | -8.42572 | -8.53912 |
HLA-B35:01 | 1A1N | 10385 | VVYGPHEVHGKKLF | -6.4428 | -7.4781 |
HLA-A02:01 | 6TDR | 10385 | VVYGPHEVHGKKLF | -5.01451 | -6.04981 |
Top |
Vaccine Design for the FusionNeoAntigens of EXOSC4-NEIL2 |
mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is. |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide sequence | FusionNeoAntigen RNA sequence |
EXOSC4-NEIL2 | chr8 | 145133800 | chr8 | 11637105 | 11 | 19 | HEVHGKKL | CACGAGGTCCATGGAAAGAAATTA |
EXOSC4-NEIL2 | chr8 | 145133800 | chr8 | 11637105 | 11 | 20 | HEVHGKKLF | CACGAGGTCCATGGAAAGAAATTATTC |
EXOSC4-NEIL2 | chr8 | 145133800 | chr8 | 11637105 | 12 | 21 | EVHGKKLFL | GAGGTCCATGGAAAGAAATTATTCCTT |
EXOSC4-NEIL2 | chr8 | 145133800 | chr8 | 11637105 | 12 | 23 | EVHGKKLFLRF | GAGGTCCATGGAAAGAAATTATTCCTTAGATTT |
EXOSC4-NEIL2 | chr8 | 145133800 | chr8 | 11637105 | 3 | 14 | ALAVVYGPHEV | GCACTGGCTGTGGTCTACGGCCCGCACGAGGTC |
EXOSC4-NEIL2 | chr8 | 145133800 | chr8 | 11637105 | 5 | 14 | AVVYGPHEV | GCTGTGGTCTACGGCCCGCACGAGGTC |
EXOSC4-NEIL2 | chr8 | 145133800 | chr8 | 11637105 | 6 | 14 | VVYGPHEV | GTGGTCTACGGCCCGCACGAGGTC |
EXOSC4-NEIL2 | chr8 | 145133800 | chr8 | 11637105 | 6 | 15 | VVYGPHEVH | GTGGTCTACGGCCCGCACGAGGTCCAT |
EXOSC4-NEIL2 | chr8 | 145133800 | chr8 | 11637105 | 6 | 17 | VVYGPHEVHGK | GTGGTCTACGGCCCGCACGAGGTCCATGGAAAG |
EXOSC4-NEIL2 | chr8 | 145133800 | chr8 | 11637105 | 9 | 19 | GPHEVHGKKL | GGCCCGCACGAGGTCCATGGAAAGAAATTA |
EXOSC4-NEIL2 | chr8 | 145133800 | chr8 | 11637105 | 9 | 20 | GPHEVHGKKLF | GGCCCGCACGAGGTCCATGGAAAGAAATTATTC |
mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs. |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide | FusionNEoAntigen RNA sequence |
Top |
Information of the samples that have these potential fusion neoantigens of EXOSC4-NEIL2 |
These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens. |
Cancer type | Fusion gene | Hchr | Hbp | Henst | Tchr | Tbp | Tenst | Sample |
MESO | EXOSC4-NEIL2 | chr8 | 145133800 | ENST00000316052 | chr8 | 11637105 | ENST00000436750 | TCGA-UD-AAC4 |
Top |
Potential target of CAR-T therapy development for EXOSC4-NEIL2 |
Predicted 3D structure. We used RoseTTAFold. |
Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features * Minus value of BPloci means that the break point is located before the CDS. |
- In-frame and retained 'Transmembrane'. |
Partner | Gene | Hbp | Tbp | ENST | Strand | BPexon | TotalExon | Protein feature loci | *BPloci | TotalLen | Protein feature | Protein feature note |
Subcellular localization prediction of the transmembrane domain retained fusion proteins * We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image. |
Hgene | Hchr | Hbp | Henst | Tgene | Tchr | Tbp | Tenst | DeepLoc result |
Top |
Related Drugs to EXOSC4-NEIL2 |
Drugs used for this fusion-positive patient. (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Drug | Source | PMID |
Top |
Related Diseases to EXOSC4-NEIL2 |
Diseases that have this fusion gene. (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Disease | Source | PMID |
Diseases associated with fusion partners. (DisGeNet 4.0) |
Partner | Gene | Disease ID | Disease name | # pubmeds | Source |