|
Fusion Protein:FBXW11-NPM1 |
Fusion Gene and Fusion Protein Summary |
Fusion gene summary |
Fusion partner gene information | Fusion gene name: FBXW11-NPM1 | FusionPDB ID: 29884 | FusionGDB2.0 ID: 29884 | Hgene | Tgene | Gene symbol | FBXW11 | NPM1 | Gene ID | 23291 | 4869 |
Gene name | F-box and WD repeat domain containing 11 | nucleophosmin 1 | |
Synonyms | BTRC2|BTRCP2|FBW1B|FBXW1B|Fbw11|Hos | B23|NPM | |
Cytomap | 5q35.1 | 5q35.1 | |
Type of gene | protein-coding | protein-coding | |
Description | F-box/WD repeat-containing protein 11F-box and WD repeats protein beta-TrCP2F-box and WD-40 domain protein 11F-box and WD-40 domain protein 1BF-box protein Fbw1bF-box/WD repeat-containing protein 1Bbeta-transducin repeat-containing protein 2homolog | nucleophosminnucleolar protein NO38nucleophosmin (nucleolar phosphoprotein B23, numatrin)nucleophosmin/nucleoplasmin family, member 1testicular tissue protein Li 128 | |
Modification date | 20200329 | 20200329 | |
UniProtAcc | Q9UKB1 Main function of 5'-partner protein: FUNCTION: Substrate recognition component of a SCF (SKP1-CUL1-F-box protein) E3 ubiquitin-protein ligase complex which mediates the ubiquitination and subsequent proteasomal degradation of target proteins. Probably recognizes and binds to phosphorylated target proteins. SCF(FBXW11) mediates the ubiquitination of phosphorylated CTNNB1 and participates in Wnt signaling. SCF(FBXW11) mediates the ubiquitination of phosphorylated NFKBIA, which degradation frees the associated NFKB1 to translocate into the nucleus and to activate transcription. SCF(FBXW11) mediates the ubiquitination of IFNAR1. SCF(FBXW11) mediates the ubiquitination of CEP68; this is required for centriole separation during mitosis (PubMed:25503564). Involved in the oxidative stress-induced a ubiquitin-mediated decrease in RCAN1. Mediates the degradation of CDC25A induced by ionizing radiation in cells progressing through S phase and thus may function in the intra-S-phase checkpoint. Has an essential role in the control of the clock-dependent transcription via degradation of phosphorylated PER1 and phosphorylated PER2. SCF(FBXW11) mediates the ubiquitination of CYTH1, and probably CYTH2 (PubMed:29420262). {ECO:0000269|PubMed:10321728, ECO:0000269|PubMed:10437795, ECO:0000269|PubMed:10644755, ECO:0000269|PubMed:10648623, ECO:0000269|PubMed:14532120, ECO:0000269|PubMed:14603323, ECO:0000269|PubMed:15917222, ECO:0000269|PubMed:18575781, ECO:0000269|PubMed:19966869, ECO:0000269|PubMed:20347421, ECO:0000269|PubMed:25503564, ECO:0000269|PubMed:29420262}.; FUNCTION: (Microbial infection) Target of human immunodeficiency virus type 1 (HIV-1) protein VPU to polyubiquitinate and deplete BST2 from cells and antagonize its antiviral action. {ECO:0000269|PubMed:19730691}. | P06748 Main function of 5'-partner protein: FUNCTION: Involved in diverse cellular processes such as ribosome biogenesis, centrosome duplication, protein chaperoning, histone assembly, cell proliferation, and regulation of tumor suppressors p53/TP53 and ARF. Binds ribosome presumably to drive ribosome nuclear export. Associated with nucleolar ribonucleoprotein structures and bind single-stranded nucleic acids. Acts as a chaperonin for the core histones H3, H2B and H4. Stimulates APEX1 endonuclease activity on apurinic/apyrimidinic (AP) double-stranded DNA but inhibits APEX1 endonuclease activity on AP single-stranded RNA. May exert a control of APEX1 endonuclease activity within nucleoli devoted to repair AP on rDNA and the removal of oxidized rRNA molecules. In concert with BRCA2, regulates centrosome duplication. Regulates centriole duplication: phosphorylation by PLK2 is able to trigger centriole replication. Negatively regulates the activation of EIF2AK2/PKR and suppresses apoptosis through inhibition of EIF2AK2/PKR autophosphorylation. Antagonizes the inhibitory effect of ATF5 on cell proliferation and relieves ATF5-induced G2/M blockade (PubMed:22528486). In complex with MYC enhances the transcription of MYC target genes (PubMed:25956029). {ECO:0000269|PubMed:12882984, ECO:0000269|PubMed:16107701, ECO:0000269|PubMed:17015463, ECO:0000269|PubMed:18809582, ECO:0000269|PubMed:19188445, ECO:0000269|PubMed:20352051, ECO:0000269|PubMed:21084279, ECO:0000269|PubMed:22002061, ECO:0000269|PubMed:22528486, ECO:0000269|PubMed:25956029}. | |
Ensembl transtripts involved in fusion gene | ENST ids | ENST00000265094, ENST00000296933, ENST00000393802, ENST00000425623, ENST00000522891, | ENST00000296930, ENST00000351986, ENST00000393820, ENST00000517671, |
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0) | * DoF score | 13 X 6 X 9=702 | 10 X 9 X 3=270 |
# samples | 13 | 11 | |
** MAII score | log2(13/702*10)=-2.43295940727611 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | log2(11/270*10)=-1.29545588352617 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | |
Fusion gene context | PubMed: FBXW11 [Title/Abstract] AND NPM1 [Title/Abstract] AND fusion [Title/Abstract] | ||
Fusion neoantigen context | PubMed: FBXW11 [Title/Abstract] AND NPM1 [Title/Abstract] AND neoantigen [Title/Abstract] | ||
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0) | FBXW11(171433461)-NPM1(170832305), # samples:1 | ||
Anticipated loss of major functional domain due to fusion event. | FBXW11-NPM1 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. FBXW11-NPM1 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. FBXW11-NPM1 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. FBXW11-NPM1 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. |
* DoF score (Degree of Frequency) = # partners X # break points X # cancer types ** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10) |
Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez |
Partner | Gene | GO ID | GO term | PubMed ID |
Hgene | FBXW11 | GO:0000209 | protein polyubiquitination | 20347421 |
Hgene | FBXW11 | GO:0016567 | protein ubiquitination | 16885022 |
Hgene | FBXW11 | GO:0031146 | SCF-dependent proteasomal ubiquitin-dependent protein catabolic process | 20347421 |
Hgene | FBXW11 | GO:0043161 | proteasome-mediated ubiquitin-dependent protein catabolic process | 20347421 |
Tgene | NPM1 | GO:0006281 | DNA repair | 19188445 |
Tgene | NPM1 | GO:0006334 | nucleosome assembly | 11602260 |
Tgene | NPM1 | GO:0006913 | nucleocytoplasmic transport | 16041368 |
Tgene | NPM1 | GO:0008104 | protein localization | 18420587 |
Tgene | NPM1 | GO:0008284 | positive regulation of cell proliferation | 22528486 |
Tgene | NPM1 | GO:0032071 | regulation of endodeoxyribonuclease activity | 19188445 |
Tgene | NPM1 | GO:0034644 | cellular response to UV | 19160485 |
Tgene | NPM1 | GO:0043066 | negative regulation of apoptotic process | 12882984 |
Tgene | NPM1 | GO:0044387 | negative regulation of protein kinase activity by regulation of protein phosphorylation | 12882984 |
Tgene | NPM1 | GO:0045727 | positive regulation of translation | 12882984 |
Tgene | NPM1 | GO:0045893 | positive regulation of transcription, DNA-templated | 22528486 |
Tgene | NPM1 | GO:0045944 | positive regulation of transcription by RNA polymerase II | 19160485 |
Tgene | NPM1 | GO:0060699 | regulation of endoribonuclease activity | 19188445 |
Tgene | NPM1 | GO:0060735 | regulation of eIF2 alpha phosphorylation by dsRNA | 12882984 |
Tgene | NPM1 | GO:1902751 | positive regulation of cell cycle G2/M phase transition | 22528486 |
Four levels of functional features of fusion genes Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr5:171433461/chr5:170832305) - FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels. - How to search 1. Put your fusion gene symbol. 2. Press the tab key until there will be shown the breakpoint information filled. 4. Go down and press 'Search' tab twice. 4. Go down to have the hyperlink of the search result. 5. Click the hyperlink. 6. See the FGviewer result for your fusion gene. |
Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here. |
Fusion gene breakpoints across FBXW11 (5'-gene) * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
Fusion gene breakpoints across NPM1 (3'-gene) * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
Top |
Fusion Amino Acid Sequences |
Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB. |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | Seq length (transcript) | BP loci (transcript) | Predicted start (transcript) | Predicted stop (transcript) | Seq length (amino acids) |
ENST00000296933 | FBXW11 | chr5 | 171433461 | - | ENST00000517671 | NPM1 | chr5 | 170832305 | + | 950 | 416 | 555 | 100 | 151 |
ENST00000296933 | FBXW11 | chr5 | 171433461 | - | ENST00000296930 | NPM1 | chr5 | 170832305 | + | 1204 | 416 | 555 | 100 | 151 |
ENST00000296933 | FBXW11 | chr5 | 171433461 | - | ENST00000351986 | NPM1 | chr5 | 170832305 | + | 951 | 416 | 28 | 393 | 121 |
ENST00000296933 | FBXW11 | chr5 | 171433461 | - | ENST00000393820 | NPM1 | chr5 | 170832305 | + | 1247 | 416 | 618 | 100 | 172 |
ENST00000265094 | FBXW11 | chr5 | 171433461 | - | ENST00000517671 | NPM1 | chr5 | 170832305 | + | 717 | 183 | 380 | 27 | 117 |
ENST00000265094 | FBXW11 | chr5 | 171433461 | - | ENST00000296930 | NPM1 | chr5 | 170832305 | + | 971 | 183 | 57 | 398 | 113 |
ENST00000265094 | FBXW11 | chr5 | 171433461 | - | ENST00000351986 | NPM1 | chr5 | 170832305 | + | 718 | 183 | 380 | 27 | 117 |
ENST00000265094 | FBXW11 | chr5 | 171433461 | - | ENST00000393820 | NPM1 | chr5 | 170832305 | + | 1014 | 183 | 385 | 2 | 128 |
ENST00000393802 | FBXW11 | chr5 | 171433461 | - | ENST00000517671 | NPM1 | chr5 | 170832305 | + | 727 | 193 | 390 | 37 | 117 |
ENST00000393802 | FBXW11 | chr5 | 171433461 | - | ENST00000296930 | NPM1 | chr5 | 170832305 | + | 981 | 193 | 67 | 408 | 113 |
ENST00000393802 | FBXW11 | chr5 | 171433461 | - | ENST00000351986 | NPM1 | chr5 | 170832305 | + | 728 | 193 | 390 | 37 | 117 |
ENST00000393802 | FBXW11 | chr5 | 171433461 | - | ENST00000393820 | NPM1 | chr5 | 170832305 | + | 1024 | 193 | 395 | 0 | 132 |
DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated. |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | No-coding score | Coding score |
ENST00000296933 | ENST00000517671 | FBXW11 | chr5 | 171433461 | - | NPM1 | chr5 | 170832305 | + | 0.7816728 | 0.21832721 |
ENST00000296933 | ENST00000296930 | FBXW11 | chr5 | 171433461 | - | NPM1 | chr5 | 170832305 | + | 0.79986024 | 0.2001397 |
ENST00000296933 | ENST00000351986 | FBXW11 | chr5 | 171433461 | - | NPM1 | chr5 | 170832305 | + | 0.77971536 | 0.22028461 |
ENST00000296933 | ENST00000393820 | FBXW11 | chr5 | 171433461 | - | NPM1 | chr5 | 170832305 | + | 0.736655 | 0.26334497 |
ENST00000265094 | ENST00000517671 | FBXW11 | chr5 | 171433461 | - | NPM1 | chr5 | 170832305 | + | 0.023349142 | 0.9766509 |
ENST00000265094 | ENST00000296930 | FBXW11 | chr5 | 171433461 | - | NPM1 | chr5 | 170832305 | + | 0.02066022 | 0.9793397 |
ENST00000265094 | ENST00000351986 | FBXW11 | chr5 | 171433461 | - | NPM1 | chr5 | 170832305 | + | 0.023542324 | 0.97645766 |
ENST00000265094 | ENST00000393820 | FBXW11 | chr5 | 171433461 | - | NPM1 | chr5 | 170832305 | + | 0.18183978 | 0.8181602 |
ENST00000393802 | ENST00000517671 | FBXW11 | chr5 | 171433461 | - | NPM1 | chr5 | 170832305 | + | 0.033044558 | 0.9669554 |
ENST00000393802 | ENST00000296930 | FBXW11 | chr5 | 171433461 | - | NPM1 | chr5 | 170832305 | + | 0.033704363 | 0.96629566 |
ENST00000393802 | ENST00000351986 | FBXW11 | chr5 | 171433461 | - | NPM1 | chr5 | 170832305 | + | 0.033040565 | 0.9669594 |
ENST00000393802 | ENST00000393820 | FBXW11 | chr5 | 171433461 | - | NPM1 | chr5 | 170832305 | + | 0.25556347 | 0.74443656 |
Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones. |
Get the fusion protein sequences from here. |
Fusion protein sequence information is available in the fasta format. >FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP |
Top |
Fusion Protein Breakpoint Sequences for FBXW11-NPM1 |
+/-13 AA sequence from the breakpoints of the fusion protein sequences. |
Hgene | Hchr | Hbp | Tgene | Tchr | Tbp | Length(fusion protein) | BP in fusion protein | Peptide |
FBXW11 | chr5 | 171433461 | NPM1 | chr5 | 170832305 | 183 | 42 | PDSVIEDKTIELMGQESFKKQEKTPK |
FBXW11 | chr5 | 171433461 | NPM1 | chr5 | 170832305 | 193 | 42 | PDSVIEDKTIELMGQESFKKQEKTPK |
Top |
Potential FusionNeoAntigen Information of FBXW11-NPM1 in HLA I |
Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific. |
FBXW11-NPM1_171433461_170832305.msa |
Potential FusionNeoAntigen Information * We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5) |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA I | FusionNeoAntigen peptide | Binding score | Immunogenic score | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
FBXW11-NPM1 | chr5 | 171433461 | chr5 | 170832305 | 183 | HLA-B18:01 | IELMGQESF | 0.9965 | 0.9572 | 9 | 18 |
FBXW11-NPM1 | chr5 | 171433461 | chr5 | 170832305 | 183 | HLA-B44:03 | IELMGQESF | 0.9957 | 0.9733 | 9 | 18 |
FBXW11-NPM1 | chr5 | 171433461 | chr5 | 170832305 | 183 | HLA-B47:01 | IELMGQESF | 0.9901 | 0.7101 | 9 | 18 |
FBXW11-NPM1 | chr5 | 171433461 | chr5 | 170832305 | 183 | HLA-B15:03 | IELMGQESF | 0.4603 | 0.8884 | 9 | 18 |
FBXW11-NPM1 | chr5 | 171433461 | chr5 | 170832305 | 183 | HLA-B39:13 | IELMGQESF | 0.0853 | 0.971 | 9 | 18 |
FBXW11-NPM1 | chr5 | 171433461 | chr5 | 170832305 | 183 | HLA-B44:03 | TIELMGQESF | 0.4348 | 0.98 | 8 | 18 |
FBXW11-NPM1 | chr5 | 171433461 | chr5 | 170832305 | 183 | HLA-B57:01 | KTIELMGQESF | 1 | 0.9937 | 7 | 18 |
FBXW11-NPM1 | chr5 | 171433461 | chr5 | 170832305 | 183 | HLA-B57:03 | KTIELMGQESF | 0.9999 | 0.9968 | 7 | 18 |
FBXW11-NPM1 | chr5 | 171433461 | chr5 | 170832305 | 183 | HLA-B58:02 | KTIELMGQESF | 0.9999 | 0.9837 | 7 | 18 |
FBXW11-NPM1 | chr5 | 171433461 | chr5 | 170832305 | 183 | HLA-B15:16 | KTIELMGQESF | 0.9998 | 0.9628 | 7 | 18 |
FBXW11-NPM1 | chr5 | 171433461 | chr5 | 170832305 | 183 | HLA-B58:01 | KTIELMGQESF | 0.9998 | 0.9874 | 7 | 18 |
FBXW11-NPM1 | chr5 | 171433461 | chr5 | 170832305 | 183 | HLA-B15:17 | KTIELMGQESF | 0.9998 | 0.9587 | 7 | 18 |
FBXW11-NPM1 | chr5 | 171433461 | chr5 | 170832305 | 183 | HLA-A32:13 | KTIELMGQESF | 0.9877 | 0.9837 | 7 | 18 |
FBXW11-NPM1 | chr5 | 171433461 | chr5 | 170832305 | 183 | HLA-B40:03 | IELMGQESF | 0.9975 | 0.5003 | 9 | 18 |
FBXW11-NPM1 | chr5 | 171433461 | chr5 | 170832305 | 183 | HLA-B39:08 | IELMGQESF | 0.4142 | 0.9499 | 9 | 18 |
FBXW11-NPM1 | chr5 | 171433461 | chr5 | 170832305 | 183 | HLA-B44:09 | TIELMGQESF | 0.5242 | 0.5575 | 8 | 18 |
FBXW11-NPM1 | chr5 | 171433461 | chr5 | 170832305 | 183 | HLA-B40:03 | KTIELMGQESF | 0.9877 | 0.6786 | 7 | 18 |
FBXW11-NPM1 | chr5 | 171433461 | chr5 | 170832305 | 183 | HLA-B18:07 | IELMGQESF | 0.9974 | 0.9383 | 9 | 18 |
FBXW11-NPM1 | chr5 | 171433461 | chr5 | 170832305 | 183 | HLA-B18:04 | IELMGQESF | 0.9972 | 0.962 | 9 | 18 |
FBXW11-NPM1 | chr5 | 171433461 | chr5 | 170832305 | 183 | HLA-B18:08 | IELMGQESF | 0.9966 | 0.9545 | 9 | 18 |
FBXW11-NPM1 | chr5 | 171433461 | chr5 | 170832305 | 183 | HLA-B18:05 | IELMGQESF | 0.9965 | 0.9572 | 9 | 18 |
FBXW11-NPM1 | chr5 | 171433461 | chr5 | 170832305 | 183 | HLA-B44:26 | IELMGQESF | 0.9957 | 0.9733 | 9 | 18 |
FBXW11-NPM1 | chr5 | 171433461 | chr5 | 170832305 | 183 | HLA-B44:13 | IELMGQESF | 0.9957 | 0.9733 | 9 | 18 |
FBXW11-NPM1 | chr5 | 171433461 | chr5 | 170832305 | 183 | HLA-B18:06 | IELMGQESF | 0.9957 | 0.9648 | 9 | 18 |
FBXW11-NPM1 | chr5 | 171433461 | chr5 | 170832305 | 183 | HLA-B44:07 | IELMGQESF | 0.9957 | 0.9733 | 9 | 18 |
FBXW11-NPM1 | chr5 | 171433461 | chr5 | 170832305 | 183 | HLA-B18:03 | IELMGQESF | 0.9873 | 0.9529 | 9 | 18 |
FBXW11-NPM1 | chr5 | 171433461 | chr5 | 170832305 | 183 | HLA-B40:04 | IELMGQESF | 0.9832 | 0.7662 | 9 | 18 |
FBXW11-NPM1 | chr5 | 171433461 | chr5 | 170832305 | 183 | HLA-B18:11 | IELMGQESF | 0.8759 | 0.9561 | 9 | 18 |
FBXW11-NPM1 | chr5 | 171433461 | chr5 | 170832305 | 183 | HLA-B15:53 | IELMGQESF | 0.6667 | 0.944 | 9 | 18 |
FBXW11-NPM1 | chr5 | 171433461 | chr5 | 170832305 | 183 | HLA-B35:28 | IELMGQESF | 0.5527 | 0.9655 | 9 | 18 |
FBXW11-NPM1 | chr5 | 171433461 | chr5 | 170832305 | 183 | HLA-B35:20 | IELMGQESF | 0.5172 | 0.968 | 9 | 18 |
FBXW11-NPM1 | chr5 | 171433461 | chr5 | 170832305 | 183 | HLA-B15:54 | IELMGQESF | 0.478 | 0.9364 | 9 | 18 |
FBXW11-NPM1 | chr5 | 171433461 | chr5 | 170832305 | 183 | HLA-B48:02 | IELMGQESF | 0.4115 | 0.9646 | 9 | 18 |
FBXW11-NPM1 | chr5 | 171433461 | chr5 | 170832305 | 183 | HLA-B41:03 | IELMGQESF | 0.3156 | 0.7723 | 9 | 18 |
FBXW11-NPM1 | chr5 | 171433461 | chr5 | 170832305 | 183 | HLA-B39:02 | IELMGQESF | 0.0958 | 0.9731 | 9 | 18 |
FBXW11-NPM1 | chr5 | 171433461 | chr5 | 170832305 | 183 | HLA-B18:11 | TIELMGQESF | 0.5995 | 0.9577 | 8 | 18 |
FBXW11-NPM1 | chr5 | 171433461 | chr5 | 170832305 | 183 | HLA-B44:13 | TIELMGQESF | 0.4348 | 0.98 | 8 | 18 |
FBXW11-NPM1 | chr5 | 171433461 | chr5 | 170832305 | 183 | HLA-B44:07 | TIELMGQESF | 0.4348 | 0.98 | 8 | 18 |
FBXW11-NPM1 | chr5 | 171433461 | chr5 | 170832305 | 183 | HLA-B44:26 | TIELMGQESF | 0.4348 | 0.98 | 8 | 18 |
FBXW11-NPM1 | chr5 | 171433461 | chr5 | 170832305 | 183 | HLA-B57:10 | KTIELMGQESF | 1 | 0.9937 | 7 | 18 |
FBXW11-NPM1 | chr5 | 171433461 | chr5 | 170832305 | 183 | HLA-B57:04 | KTIELMGQESF | 1 | 0.7482 | 7 | 18 |
FBXW11-NPM1 | chr5 | 171433461 | chr5 | 170832305 | 183 | HLA-B57:02 | KTIELMGQESF | 0.9999 | 0.942 | 7 | 18 |
FBXW11-NPM1 | chr5 | 171433461 | chr5 | 170832305 | 183 | HLA-B58:06 | KTIELMGQESF | 0.9999 | 0.9579 | 7 | 18 |
FBXW11-NPM1 | chr5 | 171433461 | chr5 | 170832305 | 183 | HLA-A32:01 | KTIELMGQESF | 0.9989 | 0.9869 | 7 | 18 |
Top |
Potential FusionNeoAntigen Information of FBXW11-NPM1 in HLA II |
Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific. |
FBXW11-NPM1_171433461_170832305.msa |
Potential FusionNeoAntigen Information * We used NetMHCIIpan v4.1 (%rank<0.5). |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA II | FusionNeoAntigen peptide | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
FBXW11-NPM1 | chr5 | 171433461 | chr5 | 170832305 | 183 | DRB1-0301 | PDSVIEDKTIELMGQ | 0 | 15 |
FBXW11-NPM1 | chr5 | 171433461 | chr5 | 170832305 | 183 | DRB1-0307 | PDSVIEDKTIELMGQ | 0 | 15 |
FBXW11-NPM1 | chr5 | 171433461 | chr5 | 170832305 | 183 | DRB1-0310 | PDSVIEDKTIELMGQ | 0 | 15 |
FBXW11-NPM1 | chr5 | 171433461 | chr5 | 170832305 | 183 | DRB1-0313 | PDSVIEDKTIELMGQ | 0 | 15 |
FBXW11-NPM1 | chr5 | 171433461 | chr5 | 170832305 | 183 | DRB1-0315 | PDSVIEDKTIELMGQ | 0 | 15 |
FBXW11-NPM1 | chr5 | 171433461 | chr5 | 170832305 | 183 | DRB1-0318 | PDSVIEDKTIELMGQ | 0 | 15 |
FBXW11-NPM1 | chr5 | 171433461 | chr5 | 170832305 | 183 | DRB1-0320 | PDSVIEDKTIELMGQ | 0 | 15 |
FBXW11-NPM1 | chr5 | 171433461 | chr5 | 170832305 | 183 | DRB1-0322 | PDSVIEDKTIELMGQ | 0 | 15 |
FBXW11-NPM1 | chr5 | 171433461 | chr5 | 170832305 | 183 | DRB1-0324 | PDSVIEDKTIELMGQ | 0 | 15 |
FBXW11-NPM1 | chr5 | 171433461 | chr5 | 170832305 | 183 | DRB1-0326 | PDSVIEDKTIELMGQ | 0 | 15 |
FBXW11-NPM1 | chr5 | 171433461 | chr5 | 170832305 | 183 | DRB1-0328 | PDSVIEDKTIELMGQ | 0 | 15 |
FBXW11-NPM1 | chr5 | 171433461 | chr5 | 170832305 | 183 | DRB1-0330 | PDSVIEDKTIELMGQ | 0 | 15 |
FBXW11-NPM1 | chr5 | 171433461 | chr5 | 170832305 | 183 | DRB1-0332 | PDSVIEDKTIELMGQ | 0 | 15 |
FBXW11-NPM1 | chr5 | 171433461 | chr5 | 170832305 | 183 | DRB1-0334 | PDSVIEDKTIELMGQ | 0 | 15 |
FBXW11-NPM1 | chr5 | 171433461 | chr5 | 170832305 | 183 | DRB1-0336 | PDSVIEDKTIELMGQ | 0 | 15 |
FBXW11-NPM1 | chr5 | 171433461 | chr5 | 170832305 | 183 | DRB1-0338 | PDSVIEDKTIELMGQ | 0 | 15 |
FBXW11-NPM1 | chr5 | 171433461 | chr5 | 170832305 | 183 | DRB1-0342 | PDSVIEDKTIELMGQ | 0 | 15 |
FBXW11-NPM1 | chr5 | 171433461 | chr5 | 170832305 | 183 | DRB1-0344 | PDSVIEDKTIELMGQ | 0 | 15 |
FBXW11-NPM1 | chr5 | 171433461 | chr5 | 170832305 | 183 | DRB1-0346 | PDSVIEDKTIELMGQ | 0 | 15 |
FBXW11-NPM1 | chr5 | 171433461 | chr5 | 170832305 | 183 | DRB1-0348 | PDSVIEDKTIELMGQ | 0 | 15 |
FBXW11-NPM1 | chr5 | 171433461 | chr5 | 170832305 | 183 | DRB1-0350 | PDSVIEDKTIELMGQ | 0 | 15 |
FBXW11-NPM1 | chr5 | 171433461 | chr5 | 170832305 | 183 | DRB1-0352 | PDSVIEDKTIELMGQ | 0 | 15 |
FBXW11-NPM1 | chr5 | 171433461 | chr5 | 170832305 | 183 | DRB1-0354 | PDSVIEDKTIELMGQ | 0 | 15 |
FBXW11-NPM1 | chr5 | 171433461 | chr5 | 170832305 | 183 | DRB1-0422 | PDSVIEDKTIELMGQ | 0 | 15 |
FBXW11-NPM1 | chr5 | 171433461 | chr5 | 170832305 | 183 | DRB1-1107 | PDSVIEDKTIELMGQ | 0 | 15 |
FBXW11-NPM1 | chr5 | 171433461 | chr5 | 170832305 | 183 | DRB1-1201 | DKTIELMGQESFKKQ | 6 | 21 |
FBXW11-NPM1 | chr5 | 171433461 | chr5 | 170832305 | 183 | DRB1-1201 | EDKTIELMGQESFKK | 5 | 20 |
FBXW11-NPM1 | chr5 | 171433461 | chr5 | 170832305 | 183 | DRB1-1201 | KTIELMGQESFKKQE | 7 | 22 |
FBXW11-NPM1 | chr5 | 171433461 | chr5 | 170832305 | 183 | DRB1-1201 | IEDKTIELMGQESFK | 4 | 19 |
FBXW11-NPM1 | chr5 | 171433461 | chr5 | 170832305 | 183 | DRB1-1203 | DKTIELMGQESFKKQ | 6 | 21 |
FBXW11-NPM1 | chr5 | 171433461 | chr5 | 170832305 | 183 | DRB1-1203 | EDKTIELMGQESFKK | 5 | 20 |
FBXW11-NPM1 | chr5 | 171433461 | chr5 | 170832305 | 183 | DRB1-1203 | KTIELMGQESFKKQE | 7 | 22 |
FBXW11-NPM1 | chr5 | 171433461 | chr5 | 170832305 | 183 | DRB1-1203 | IEDKTIELMGQESFK | 4 | 19 |
FBXW11-NPM1 | chr5 | 171433461 | chr5 | 170832305 | 183 | DRB1-1204 | DKTIELMGQESFKKQ | 6 | 21 |
FBXW11-NPM1 | chr5 | 171433461 | chr5 | 170832305 | 183 | DRB1-1205 | DKTIELMGQESFKKQ | 6 | 21 |
FBXW11-NPM1 | chr5 | 171433461 | chr5 | 170832305 | 183 | DRB1-1205 | EDKTIELMGQESFKK | 5 | 20 |
FBXW11-NPM1 | chr5 | 171433461 | chr5 | 170832305 | 183 | DRB1-1205 | KTIELMGQESFKKQE | 7 | 22 |
FBXW11-NPM1 | chr5 | 171433461 | chr5 | 170832305 | 183 | DRB1-1205 | IEDKTIELMGQESFK | 4 | 19 |
FBXW11-NPM1 | chr5 | 171433461 | chr5 | 170832305 | 183 | DRB1-1206 | DKTIELMGQESFKKQ | 6 | 21 |
FBXW11-NPM1 | chr5 | 171433461 | chr5 | 170832305 | 183 | DRB1-1206 | EDKTIELMGQESFKK | 5 | 20 |
FBXW11-NPM1 | chr5 | 171433461 | chr5 | 170832305 | 183 | DRB1-1206 | KTIELMGQESFKKQE | 7 | 22 |
FBXW11-NPM1 | chr5 | 171433461 | chr5 | 170832305 | 183 | DRB1-1206 | IEDKTIELMGQESFK | 4 | 19 |
FBXW11-NPM1 | chr5 | 171433461 | chr5 | 170832305 | 183 | DRB1-1207 | DKTIELMGQESFKKQ | 6 | 21 |
FBXW11-NPM1 | chr5 | 171433461 | chr5 | 170832305 | 183 | DRB1-1207 | EDKTIELMGQESFKK | 5 | 20 |
FBXW11-NPM1 | chr5 | 171433461 | chr5 | 170832305 | 183 | DRB1-1207 | KTIELMGQESFKKQE | 7 | 22 |
FBXW11-NPM1 | chr5 | 171433461 | chr5 | 170832305 | 183 | DRB1-1207 | IEDKTIELMGQESFK | 4 | 19 |
FBXW11-NPM1 | chr5 | 171433461 | chr5 | 170832305 | 183 | DRB1-1208 | DKTIELMGQESFKKQ | 6 | 21 |
FBXW11-NPM1 | chr5 | 171433461 | chr5 | 170832305 | 183 | DRB1-1208 | EDKTIELMGQESFKK | 5 | 20 |
FBXW11-NPM1 | chr5 | 171433461 | chr5 | 170832305 | 183 | DRB1-1209 | DKTIELMGQESFKKQ | 6 | 21 |
FBXW11-NPM1 | chr5 | 171433461 | chr5 | 170832305 | 183 | DRB1-1210 | DKTIELMGQESFKKQ | 6 | 21 |
FBXW11-NPM1 | chr5 | 171433461 | chr5 | 170832305 | 183 | DRB1-1210 | EDKTIELMGQESFKK | 5 | 20 |
FBXW11-NPM1 | chr5 | 171433461 | chr5 | 170832305 | 183 | DRB1-1210 | KTIELMGQESFKKQE | 7 | 22 |
FBXW11-NPM1 | chr5 | 171433461 | chr5 | 170832305 | 183 | DRB1-1210 | IEDKTIELMGQESFK | 4 | 19 |
FBXW11-NPM1 | chr5 | 171433461 | chr5 | 170832305 | 183 | DRB1-1211 | DKTIELMGQESFKKQ | 6 | 21 |
FBXW11-NPM1 | chr5 | 171433461 | chr5 | 170832305 | 183 | DRB1-1211 | EDKTIELMGQESFKK | 5 | 20 |
FBXW11-NPM1 | chr5 | 171433461 | chr5 | 170832305 | 183 | DRB1-1211 | KTIELMGQESFKKQE | 7 | 22 |
FBXW11-NPM1 | chr5 | 171433461 | chr5 | 170832305 | 183 | DRB1-1211 | IEDKTIELMGQESFK | 4 | 19 |
FBXW11-NPM1 | chr5 | 171433461 | chr5 | 170832305 | 183 | DRB1-1212 | DKTIELMGQESFKKQ | 6 | 21 |
FBXW11-NPM1 | chr5 | 171433461 | chr5 | 170832305 | 183 | DRB1-1212 | EDKTIELMGQESFKK | 5 | 20 |
FBXW11-NPM1 | chr5 | 171433461 | chr5 | 170832305 | 183 | DRB1-1212 | KTIELMGQESFKKQE | 7 | 22 |
FBXW11-NPM1 | chr5 | 171433461 | chr5 | 170832305 | 183 | DRB1-1212 | IEDKTIELMGQESFK | 4 | 19 |
FBXW11-NPM1 | chr5 | 171433461 | chr5 | 170832305 | 183 | DRB1-1213 | DKTIELMGQESFKKQ | 6 | 21 |
FBXW11-NPM1 | chr5 | 171433461 | chr5 | 170832305 | 183 | DRB1-1213 | EDKTIELMGQESFKK | 5 | 20 |
FBXW11-NPM1 | chr5 | 171433461 | chr5 | 170832305 | 183 | DRB1-1213 | KTIELMGQESFKKQE | 7 | 22 |
FBXW11-NPM1 | chr5 | 171433461 | chr5 | 170832305 | 183 | DRB1-1214 | DKTIELMGQESFKKQ | 6 | 21 |
FBXW11-NPM1 | chr5 | 171433461 | chr5 | 170832305 | 183 | DRB1-1214 | EDKTIELMGQESFKK | 5 | 20 |
FBXW11-NPM1 | chr5 | 171433461 | chr5 | 170832305 | 183 | DRB1-1214 | KTIELMGQESFKKQE | 7 | 22 |
FBXW11-NPM1 | chr5 | 171433461 | chr5 | 170832305 | 183 | DRB1-1214 | IEDKTIELMGQESFK | 4 | 19 |
FBXW11-NPM1 | chr5 | 171433461 | chr5 | 170832305 | 183 | DRB1-1215 | DKTIELMGQESFKKQ | 6 | 21 |
FBXW11-NPM1 | chr5 | 171433461 | chr5 | 170832305 | 183 | DRB1-1215 | EDKTIELMGQESFKK | 5 | 20 |
FBXW11-NPM1 | chr5 | 171433461 | chr5 | 170832305 | 183 | DRB1-1215 | KTIELMGQESFKKQE | 7 | 22 |
FBXW11-NPM1 | chr5 | 171433461 | chr5 | 170832305 | 183 | DRB1-1216 | DKTIELMGQESFKKQ | 6 | 21 |
FBXW11-NPM1 | chr5 | 171433461 | chr5 | 170832305 | 183 | DRB1-1216 | EDKTIELMGQESFKK | 5 | 20 |
FBXW11-NPM1 | chr5 | 171433461 | chr5 | 170832305 | 183 | DRB1-1217 | DKTIELMGQESFKKQ | 6 | 21 |
FBXW11-NPM1 | chr5 | 171433461 | chr5 | 170832305 | 183 | DRB1-1217 | EDKTIELMGQESFKK | 5 | 20 |
FBXW11-NPM1 | chr5 | 171433461 | chr5 | 170832305 | 183 | DRB1-1217 | KTIELMGQESFKKQE | 7 | 22 |
FBXW11-NPM1 | chr5 | 171433461 | chr5 | 170832305 | 183 | DRB1-1217 | IEDKTIELMGQESFK | 4 | 19 |
FBXW11-NPM1 | chr5 | 171433461 | chr5 | 170832305 | 183 | DRB1-1218 | DKTIELMGQESFKKQ | 6 | 21 |
FBXW11-NPM1 | chr5 | 171433461 | chr5 | 170832305 | 183 | DRB1-1218 | EDKTIELMGQESFKK | 5 | 20 |
FBXW11-NPM1 | chr5 | 171433461 | chr5 | 170832305 | 183 | DRB1-1218 | KTIELMGQESFKKQE | 7 | 22 |
FBXW11-NPM1 | chr5 | 171433461 | chr5 | 170832305 | 183 | DRB1-1219 | DKTIELMGQESFKKQ | 6 | 21 |
FBXW11-NPM1 | chr5 | 171433461 | chr5 | 170832305 | 183 | DRB1-1219 | EDKTIELMGQESFKK | 5 | 20 |
FBXW11-NPM1 | chr5 | 171433461 | chr5 | 170832305 | 183 | DRB1-1219 | KTIELMGQESFKKQE | 7 | 22 |
FBXW11-NPM1 | chr5 | 171433461 | chr5 | 170832305 | 183 | DRB1-1220 | DKTIELMGQESFKKQ | 6 | 21 |
FBXW11-NPM1 | chr5 | 171433461 | chr5 | 170832305 | 183 | DRB1-1220 | EDKTIELMGQESFKK | 5 | 20 |
FBXW11-NPM1 | chr5 | 171433461 | chr5 | 170832305 | 183 | DRB1-1221 | DKTIELMGQESFKKQ | 6 | 21 |
FBXW11-NPM1 | chr5 | 171433461 | chr5 | 170832305 | 183 | DRB1-1221 | EDKTIELMGQESFKK | 5 | 20 |
FBXW11-NPM1 | chr5 | 171433461 | chr5 | 170832305 | 183 | DRB1-1221 | KTIELMGQESFKKQE | 7 | 22 |
FBXW11-NPM1 | chr5 | 171433461 | chr5 | 170832305 | 183 | DRB1-1222 | DKTIELMGQESFKKQ | 6 | 21 |
FBXW11-NPM1 | chr5 | 171433461 | chr5 | 170832305 | 183 | DRB1-1222 | EDKTIELMGQESFKK | 5 | 20 |
FBXW11-NPM1 | chr5 | 171433461 | chr5 | 170832305 | 183 | DRB1-1223 | DKTIELMGQESFKKQ | 6 | 21 |
FBXW11-NPM1 | chr5 | 171433461 | chr5 | 170832305 | 183 | DRB1-1223 | EDKTIELMGQESFKK | 5 | 20 |
FBXW11-NPM1 | chr5 | 171433461 | chr5 | 170832305 | 183 | DRB1-1223 | KTIELMGQESFKKQE | 7 | 22 |
FBXW11-NPM1 | chr5 | 171433461 | chr5 | 170832305 | 183 | DRB1-1377 | DKTIELMGQESFKKQ | 6 | 21 |
FBXW11-NPM1 | chr5 | 171433461 | chr5 | 170832305 | 183 | DRB1-1476 | PDSVIEDKTIELMGQ | 0 | 15 |
FBXW11-NPM1 | chr5 | 171433461 | chr5 | 170832305 | 183 | DRB1-1479 | PDSVIEDKTIELMGQ | 0 | 15 |
FBXW11-NPM1 | chr5 | 171433461 | chr5 | 170832305 | 183 | DRB1-1525 | PDSVIEDKTIELMGQ | 0 | 15 |
FBXW11-NPM1 | chr5 | 171433461 | chr5 | 170832305 | 183 | DRB3-0101 | PDSVIEDKTIELMGQ | 0 | 15 |
FBXW11-NPM1 | chr5 | 171433461 | chr5 | 170832305 | 183 | DRB3-0104 | PDSVIEDKTIELMGQ | 0 | 15 |
FBXW11-NPM1 | chr5 | 171433461 | chr5 | 170832305 | 183 | DRB3-0105 | PDSVIEDKTIELMGQ | 0 | 15 |
FBXW11-NPM1 | chr5 | 171433461 | chr5 | 170832305 | 183 | DRB3-0108 | PDSVIEDKTIELMGQ | 0 | 15 |
FBXW11-NPM1 | chr5 | 171433461 | chr5 | 170832305 | 183 | DRB3-0109 | PDSVIEDKTIELMGQ | 0 | 15 |
FBXW11-NPM1 | chr5 | 171433461 | chr5 | 170832305 | 183 | DRB3-0111 | PDSVIEDKTIELMGQ | 0 | 15 |
FBXW11-NPM1 | chr5 | 171433461 | chr5 | 170832305 | 183 | DRB3-0112 | PDSVIEDKTIELMGQ | 0 | 15 |
FBXW11-NPM1 | chr5 | 171433461 | chr5 | 170832305 | 183 | DRB3-0113 | PDSVIEDKTIELMGQ | 0 | 15 |
FBXW11-NPM1 | chr5 | 171433461 | chr5 | 170832305 | 183 | DRB3-0114 | PDSVIEDKTIELMGQ | 0 | 15 |
FBXW11-NPM1 | chr5 | 171433461 | chr5 | 170832305 | 183 | DRB5-0106 | TIELMGQESFKKQEK | 8 | 23 |
Top |
Fusion breakpoint peptide structures of FBXW11-NPM1 |
3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens * The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA. |
File name | BPseq | Hgene | Tgene | Hchr | Hbp | Tchr | Tbp | AAlen |
1194 | DKTIELMGQESFKK | FBXW11 | NPM1 | chr5 | 171433461 | chr5 | 170832305 | 183 |
Top |
Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of FBXW11-NPM1 |
Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens * We used Glide to predict the interaction between HLAs and neoantigens. |
HLA allele | PDB ID | File name | BPseq | Docking score | Glide score |
HLA-B14:02 | 3BVN | 1194 | DKTIELMGQESFKK | -7.15543 | -7.26883 |
HLA-B14:02 | 3BVN | 1194 | DKTIELMGQESFKK | -4.77435 | -5.80965 |
HLA-B52:01 | 3W39 | 1194 | DKTIELMGQESFKK | -6.80875 | -6.92215 |
HLA-B52:01 | 3W39 | 1194 | DKTIELMGQESFKK | -4.20386 | -5.23916 |
HLA-A11:01 | 4UQ2 | 1194 | DKTIELMGQESFKK | -7.5194 | -8.5547 |
HLA-A11:01 | 4UQ2 | 1194 | DKTIELMGQESFKK | -6.9601 | -7.0735 |
HLA-A24:02 | 5HGA | 1194 | DKTIELMGQESFKK | -7.52403 | -7.63743 |
HLA-A24:02 | 5HGA | 1194 | DKTIELMGQESFKK | -5.82433 | -6.85963 |
HLA-B27:05 | 6PYJ | 1194 | DKTIELMGQESFKK | -3.28285 | -4.31815 |
HLA-B44:05 | 3DX8 | 1194 | DKTIELMGQESFKK | -5.91172 | -6.94702 |
HLA-B44:05 | 3DX8 | 1194 | DKTIELMGQESFKK | -4.24346 | -4.35686 |
Top |
Vaccine Design for the FusionNeoAntigens of FBXW11-NPM1 |
mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is. |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide sequence | FusionNeoAntigen RNA sequence |
FBXW11-NPM1 | chr5 | 171433461 | chr5 | 170832305 | 7 | 18 | KTIELMGQESF | AAGACCATCGAGCTCATGGGACAAGAATCCTTC |
FBXW11-NPM1 | chr5 | 171433461 | chr5 | 170832305 | 8 | 18 | TIELMGQESF | ACCATCGAGCTCATGGGACAAGAATCCTTC |
FBXW11-NPM1 | chr5 | 171433461 | chr5 | 170832305 | 9 | 18 | IELMGQESF | ATCGAGCTCATGGGACAAGAATCCTTC |
mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs. |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide | FusionNEoAntigen RNA sequence |
FBXW11-NPM1 | chr5 | 171433461 | chr5 | 170832305 | 0 | 15 | PDSVIEDKTIELMGQ | CCCGACTCGGTGATTGAGGACAAGACCATCGAGCTCATGGGACAA |
FBXW11-NPM1 | chr5 | 171433461 | chr5 | 170832305 | 4 | 19 | IEDKTIELMGQESFK | ATTGAGGACAAGACCATCGAGCTCATGGGACAAGAATCCTTCAAG |
FBXW11-NPM1 | chr5 | 171433461 | chr5 | 170832305 | 5 | 20 | EDKTIELMGQESFKK | GAGGACAAGACCATCGAGCTCATGGGACAAGAATCCTTCAAGAAA |
FBXW11-NPM1 | chr5 | 171433461 | chr5 | 170832305 | 6 | 21 | DKTIELMGQESFKKQ | GACAAGACCATCGAGCTCATGGGACAAGAATCCTTCAAGAAACAG |
FBXW11-NPM1 | chr5 | 171433461 | chr5 | 170832305 | 7 | 22 | KTIELMGQESFKKQE | AAGACCATCGAGCTCATGGGACAAGAATCCTTCAAGAAACAGGAA |
FBXW11-NPM1 | chr5 | 171433461 | chr5 | 170832305 | 8 | 23 | TIELMGQESFKKQEK | ACCATCGAGCTCATGGGACAAGAATCCTTCAAGAAACAGGAAAAA |
Top |
Information of the samples that have these potential fusion neoantigens of FBXW11-NPM1 |
These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens. |
Cancer type | Fusion gene | Hchr | Hbp | Henst | Tchr | Tbp | Tenst | Sample |
OV | FBXW11-NPM1 | chr5 | 171433461 | ENST00000265094 | chr5 | 170832305 | ENST00000296930 | TCGA-24-1563 |
Top |
Potential target of CAR-T therapy development for FBXW11-NPM1 |
Predicted 3D structure. We used RoseTTAFold. |
Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features * Minus value of BPloci means that the break point is located before the CDS. |
- In-frame and retained 'Transmembrane'. |
Partner | Gene | Hbp | Tbp | ENST | Strand | BPexon | TotalExon | Protein feature loci | *BPloci | TotalLen | Protein feature | Protein feature note |
Subcellular localization prediction of the transmembrane domain retained fusion proteins * We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image. |
Hgene | Hchr | Hbp | Henst | Tgene | Tchr | Tbp | Tenst | DeepLoc result |
Top |
Related Drugs to FBXW11-NPM1 |
Drugs used for this fusion-positive patient. (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Drug | Source | PMID |
Top |
Related Diseases to FBXW11-NPM1 |
Diseases that have this fusion gene. (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Disease | Source | PMID |
Diseases associated with fusion partners. (DisGeNet 4.0) |
Partner | Gene | Disease ID | Disease name | # pubmeds | Source |
Tgene | NPM1 | C0026998 | Acute Myeloid Leukemia, M1 | 6 | CTD_human;ORPHANET |
Tgene | NPM1 | C1879321 | Acute Myeloid Leukemia (AML-M2) | 6 | CTD_human;ORPHANET |
Tgene | NPM1 | C0023467 | Leukemia, Myelocytic, Acute | 5 | CGI;CTD_human |
Tgene | NPM1 | C0023487 | Acute Promyelocytic Leukemia | 2 | CGI;CTD_human;ORPHANET |
Tgene | NPM1 | C0024623 | Malignant neoplasm of stomach | 1 | CTD_human |
Tgene | NPM1 | C0038356 | Stomach Neoplasms | 1 | CTD_human |
Tgene | NPM1 | C0152013 | Adenocarcinoma of lung (disorder) | 1 | CTD_human |
Tgene | NPM1 | C0206182 | Lymphomatoid Papulosis | 1 | ORPHANET |
Tgene | NPM1 | C0265965 | Dyskeratosis Congenita | 1 | CTD_human;GENOMICS_ENGLAND |
Tgene | NPM1 | C1148551 | X-Linked Dyskeratosis Congenita | 1 | CTD_human |
Tgene | NPM1 | C1301362 | Primary Cutaneous Anaplastic Large Cell Lymphoma | 1 | ORPHANET |
Tgene | NPM1 | C1708349 | Hereditary Diffuse Gastric Cancer | 1 | CTD_human |
Tgene | NPM1 | C2930974 | Acute erythroleukemia | 1 | CTD_human |
Tgene | NPM1 | C2930975 | Acute erythroleukemia - M6a subtype | 1 | CTD_human |
Tgene | NPM1 | C2930976 | Acute myeloid leukemia FAB-M6 | 1 | CTD_human |
Tgene | NPM1 | C2930977 | Acute erythroleukemia - M6b subtype | 1 | CTD_human |