Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:STAT3-C1orf43

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: STAT3-C1orf43
	FusionPDB ID: 87239
	FusionGDB2.0 ID: 87239
		Hgene	Tgene
	Gene symbol	STAT3	C1orf43
	Gene ID	6774	25912
	Gene name	signal transducer and activator of transcription 3	chromosome 1 open reading frame 43
	Synonyms	ADMIO\|ADMIO1\|APRF\|HIES	HSPC012\|NICE-3\|NICE3\|NS5ATP4\|S863-3
	Cytomap	17q21.2	1q21.3
	Type of gene	protein-coding	protein-coding
	Description	signal transducer and activator of transcription 3DNA-binding protein APRFacute-phase response factor	uncharacterized protein C1orf43HCV NS5A-transactivated protein 4hepatitis C virus NS5A-transactivated protein 4
	Modification date	20200329	20200327
	UniProtAcc	.	Q9BWL3 Main function of 5'-partner protein: FUNCTION: General regulator of phagocytosis. Required to uptake Gram negative bacterium by macrophages. {ECO:0000269\|PubMed:31540829}.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000264657, ENST00000389272, ENST00000404395, ENST00000585517, ENST00000588969, ENST00000590776,	ENST00000483282, ENST00000368516, ENST00000368518, ENST00000350592, ENST00000362076, ENST00000368519, ENST00000368521,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	18 X 20 X 10=3600	5 X 5 X 4=100
	# samples	23	5
	** MAII score	log2(23/3600*10)=-3.96829114027266 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(5/100*10)=-1 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: STAT3 [Title/Abstract] AND C1orf43 [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: STAT3 [Title/Abstract] AND C1orf43 [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	STAT3(40497577)-C1orf43(154180124), # samples:2
Anticipated loss of major functional domain due to fusion event.	STAT3-C1orf43 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. STAT3-C1orf43 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. STAT3-C1orf43 seems lost the major protein functional domain in Hgene partner, which is a CGC due to the frame-shifted ORF. STAT3-C1orf43 seems lost the major protein functional domain in Hgene partner, which is a IUPHAR drug target due to the frame-shifted ORF. STAT3-C1orf43 seems lost the major protein functional domain in Hgene partner, which is a transcription factor due to the frame-shifted ORF. STAT3-C1orf43 seems lost the major protein functional domain in Hgene partner, which is a tumor suppressor due to the frame-shifted ORF. STAT3-C1orf43 seems lost the major protein functional domain in Tgene partner, which is a essential gene due to the frame-shifted ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Hgene	STAT3	GO:0006355	regulation of transcription, DNA-templated	15664994\|17344214
Hgene	STAT3	GO:0006606	protein import into nucleus	18234692
Hgene	STAT3	GO:0010507	negative regulation of autophagy	26962683
Hgene	STAT3	GO:0010628	positive regulation of gene expression	23820254
Hgene	STAT3	GO:0030522	intracellular receptor signaling pathway	17324931
Hgene	STAT3	GO:0032355	response to estradiol	12552091
Hgene	STAT3	GO:0032870	cellular response to hormone stimulus	12552091
Hgene	STAT3	GO:0033210	leptin-mediated signaling pathway	17344214
Hgene	STAT3	GO:0035278	miRNA mediated inhibition of translation	23820254
Hgene	STAT3	GO:0044320	cellular response to leptin stimulus	17344214
Hgene	STAT3	GO:0044321	response to leptin	17344214
Hgene	STAT3	GO:0045893	positive regulation of transcription, DNA-templated	19390056
Hgene	STAT3	GO:0045944	positive regulation of transcription by RNA polymerase II	17324931\|27050391\|31462771
Hgene	STAT3	GO:0051726	regulation of cell cycle	17344214
Hgene	STAT3	GO:0060396	growth hormone receptor signaling pathway	10925297
Hgene	STAT3	GO:0060397	JAK-STAT cascade involved in growth hormone signaling pathway	12552091
Hgene	STAT3	GO:0070102	interleukin-6-mediated signaling pathway	12359225\|12552091\|17324931\|24429361
Hgene	STAT3	GO:1902895	positive regulation of pri-miRNA transcription by RNA polymerase II	19390056\|23820254
Hgene	STAT3	GO:2000637	positive regulation of gene silencing by miRNA	23820254

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr17:40497577/chr1:154180124)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across STAT3 (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across C1orf43 (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000585517	STAT3	chr17	40497577	-	ENST00000368521	C1orf43	chr1	154180124	-	1480	537	193	732	179
ENST00000585517	STAT3	chr17	40497577	-	ENST00000350592	C1orf43	chr1	154180124	-	1466	537	193	732	179
ENST00000585517	STAT3	chr17	40497577	-	ENST00000368519	C1orf43	chr1	154180124	-	1010	537	193	732	179
ENST00000389272	STAT3	chr17	40497577	-	ENST00000368521	C1orf43	chr1	154180124	-	1340	397	158	592	144
ENST00000389272	STAT3	chr17	40497577	-	ENST00000350592	C1orf43	chr1	154180124	-	1326	397	158	592	144
ENST00000389272	STAT3	chr17	40497577	-	ENST00000368519	C1orf43	chr1	154180124	-	870	397	158	592	144
ENST00000588969	STAT3	chr17	40497577	-	ENST00000368521	C1orf43	chr1	154180124	-	1520	577	13	582	189
ENST00000588969	STAT3	chr17	40497577	-	ENST00000350592	C1orf43	chr1	154180124	-	1506	577	13	582	189
ENST00000588969	STAT3	chr17	40497577	-	ENST00000368519	C1orf43	chr1	154180124	-	1050	577	13	582	189
ENST00000404395	STAT3	chr17	40497577	-	ENST00000368521	C1orf43	chr1	154180124	-	1452	509	165	704	179
ENST00000404395	STAT3	chr17	40497577	-	ENST00000350592	C1orf43	chr1	154180124	-	1438	509	165	704	179
ENST00000404395	STAT3	chr17	40497577	-	ENST00000368519	C1orf43	chr1	154180124	-	982	509	165	704	179

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000585517	ENST00000368521	STAT3	chr17	40497577	-	C1orf43	chr1	154180124	-	0.30178827	0.6982118
ENST00000585517	ENST00000350592	STAT3	chr17	40497577	-	C1orf43	chr1	154180124	-	0.3278077	0.67219234
ENST00000585517	ENST00000368519	STAT3	chr17	40497577	-	C1orf43	chr1	154180124	-	0.11955846	0.8804416
ENST00000389272	ENST00000368521	STAT3	chr17	40497577	-	C1orf43	chr1	154180124	-	0.23582916	0.7641708
ENST00000389272	ENST00000350592	STAT3	chr17	40497577	-	C1orf43	chr1	154180124	-	0.2643285	0.73567146
ENST00000389272	ENST00000368519	STAT3	chr17	40497577	-	C1orf43	chr1	154180124	-	0.0716236	0.92837644
ENST00000588969	ENST00000368521	STAT3	chr17	40497577	-	C1orf43	chr1	154180124	-	0.23223081	0.7677692
ENST00000588969	ENST00000350592	STAT3	chr17	40497577	-	C1orf43	chr1	154180124	-	0.2622374	0.7377626
ENST00000588969	ENST00000368519	STAT3	chr17	40497577	-	C1orf43	chr1	154180124	-	0.12236421	0.8776358
ENST00000404395	ENST00000368521	STAT3	chr17	40497577	-	C1orf43	chr1	154180124	-	0.31833568	0.68166435
ENST00000404395	ENST00000350592	STAT3	chr17	40497577	-	C1orf43	chr1	154180124	-	0.3491597	0.65084034
ENST00000404395	ENST00000368519	STAT3	chr17	40497577	-	C1orf43	chr1	154180124	-	0.15380391	0.8461961

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for STAT3-C1orf43

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
STAT3	chr17	40497577	C1orf43	chr1	154180124	397	79	KNHAFYRLQPLRPRVKARIGSSQRHH
STAT3	chr17	40497577	C1orf43	chr1	154180124	509	114	KNHAFYRLQPLRPRVKARIGSSQRHH
STAT3	chr17	40497577	C1orf43	chr1	154180124	537	114	KNHAFYRLQPLRPRVKARIGSSQRHH

Top

Potential FusionNeoAntigen Information of STAT3-C1orf43 in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

STAT3-C1orf43_40497577_154180124.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
STAT3-C1orf43	chr17	40497577	chr1	154180124	397	HLA-A31:02	RLQPLRPR	0.9933	0.8439	6	14
STAT3-C1orf43	chr17	40497577	chr1	154180124	397	HLA-A31:06	RLQPLRPR	0.9915	0.7458	6	14
STAT3-C1orf43	chr17	40497577	chr1	154180124	397	HLA-B27:05	YRLQPLRPR	0.9994	0.7815	5	14
STAT3-C1orf43	chr17	40497577	chr1	154180124	397	HLA-B27:04	YRLQPLRPR	0.998	0.6769	5	14
STAT3-C1orf43	chr17	40497577	chr1	154180124	397	HLA-A02:22	RLQPLRPRV	0.9949	0.8077	6	15
STAT3-C1orf43	chr17	40497577	chr1	154180124	397	HLA-A02:13	RLQPLRPRV	0.9946	0.781	6	15
STAT3-C1orf43	chr17	40497577	chr1	154180124	397	HLA-A02:04	RLQPLRPRV	0.9903	0.8931	6	15
STAT3-C1orf43	chr17	40497577	chr1	154180124	397	HLA-A02:11	RLQPLRPRV	0.9901	0.7946	6	15
STAT3-C1orf43	chr17	40497577	chr1	154180124	397	HLA-A02:27	RLQPLRPRV	0.9899	0.7365	6	15
STAT3-C1orf43	chr17	40497577	chr1	154180124	397	HLA-A02:60	RLQPLRPRV	0.9885	0.8134	6	15
STAT3-C1orf43	chr17	40497577	chr1	154180124	397	HLA-A02:17	RLQPLRPRV	0.9882	0.8792	6	15
STAT3-C1orf43	chr17	40497577	chr1	154180124	397	HLA-A02:67	RLQPLRPRV	0.9882	0.804	6	15
STAT3-C1orf43	chr17	40497577	chr1	154180124	397	HLA-A02:24	RLQPLRPRV	0.9882	0.804	6	15
STAT3-C1orf43	chr17	40497577	chr1	154180124	397	HLA-A02:30	RLQPLRPRV	0.9882	0.804	6	15
STAT3-C1orf43	chr17	40497577	chr1	154180124	397	HLA-A02:38	RLQPLRPRV	0.9869	0.7664	6	15
STAT3-C1orf43	chr17	40497577	chr1	154180124	397	HLA-A02:21	RLQPLRPRV	0.9868	0.8703	6	15
STAT3-C1orf43	chr17	40497577	chr1	154180124	397	HLA-A02:16	RLQPLRPRV	0.98	0.6028	6	15
STAT3-C1orf43	chr17	40497577	chr1	154180124	397	HLA-A02:19	RLQPLRPRV	0.9505	0.7241	6	15
STAT3-C1orf43	chr17	40497577	chr1	154180124	397	HLA-A30:08	RLQPLRPRV	0.9475	0.7953	6	15
STAT3-C1orf43	chr17	40497577	chr1	154180124	397	HLA-A02:35	RLQPLRPRV	0.9021	0.7919	6	15
STAT3-C1orf43	chr17	40497577	chr1	154180124	397	HLA-A02:29	RLQPLRPRV	0.8961	0.7979	6	15
STAT3-C1orf43	chr17	40497577	chr1	154180124	397	HLA-A02:20	RLQPLRPRV	0.8639	0.8069	6	15
STAT3-C1orf43	chr17	40497577	chr1	154180124	397	HLA-B08:09	QPLRPRVKA	0.8278	0.5794	8	17
STAT3-C1orf43	chr17	40497577	chr1	154180124	397	HLA-B13:02	RLQPLRPRV	0.2085	0.9719	6	15
STAT3-C1orf43	chr17	40497577	chr1	154180124	397	HLA-A30:08	RLQPLRPRVK	0.9925	0.7784	6	16
STAT3-C1orf43	chr17	40497577	chr1	154180124	397	HLA-A74:11	RLQPLRPRVK	0.966	0.5732	6	16
STAT3-C1orf43	chr17	40497577	chr1	154180124	397	HLA-A74:03	RLQPLRPRVK	0.966	0.5732	6	16
STAT3-C1orf43	chr17	40497577	chr1	154180124	397	HLA-A74:09	RLQPLRPRVK	0.966	0.5732	6	16
STAT3-C1orf43	chr17	40497577	chr1	154180124	397	HLA-A31:02	FYRLQPLRPR	0.9018	0.7287	4	14
STAT3-C1orf43	chr17	40497577	chr1	154180124	397	HLA-B27:05	YRLQPLRPRVK	0.9999	0.7744	5	16
STAT3-C1orf43	chr17	40497577	chr1	154180124	397	HLA-A31:02	AFYRLQPLRPR	0.9766	0.7526	3	14
STAT3-C1orf43	chr17	40497577	chr1	154180124	397	HLA-A31:01	RLQPLRPR	0.9969	0.8093	6	14
STAT3-C1orf43	chr17	40497577	chr1	154180124	397	HLA-B27:14	YRLQPLRPR	0.9993	0.7472	5	14
STAT3-C1orf43	chr17	40497577	chr1	154180124	397	HLA-A02:02	RLQPLRPRV	0.9953	0.7578	6	15
STAT3-C1orf43	chr17	40497577	chr1	154180124	397	HLA-A02:07	RLQPLRPRV	0.9896	0.8472	6	15
STAT3-C1orf43	chr17	40497577	chr1	154180124	397	HLA-A02:01	RLQPLRPRV	0.9882	0.804	6	15
STAT3-C1orf43	chr17	40497577	chr1	154180124	397	HLA-B27:03	YRLQPLRPR	0.954	0.8012	5	14
STAT3-C1orf43	chr17	40497577	chr1	154180124	397	HLA-B27:14	YRLQPLRPRVK	0.9997	0.7249	5	16
STAT3-C1orf43	chr17	40497577	chr1	154180124	397	HLA-A31:01	AFYRLQPLRPR	0.9856	0.7034	3	14
STAT3-C1orf43	chr17	40497577	chr1	154180124	397	HLA-B27:08	YRLQPLRPR	0.9994	0.7076	5	14
STAT3-C1orf43	chr17	40497577	chr1	154180124	397	HLA-B27:10	YRLQPLRPR	0.9989	0.7945	5	14
STAT3-C1orf43	chr17	40497577	chr1	154180124	397	HLA-A02:03	RLQPLRPRV	0.9958	0.8316	6	15
STAT3-C1orf43	chr17	40497577	chr1	154180124	397	HLA-A02:14	RLQPLRPRV	0.9872	0.8764	6	15
STAT3-C1orf43	chr17	40497577	chr1	154180124	397	HLA-A02:06	RLQPLRPRV	0.9868	0.8703	6	15
STAT3-C1orf43	chr17	40497577	chr1	154180124	397	HLA-A30:01	RLQPLRPRV	0.9572	0.8894	6	15
STAT3-C1orf43	chr17	40497577	chr1	154180124	397	HLA-A32:01	RLQPLRPRV	0.894	0.9817	6	15
STAT3-C1orf43	chr17	40497577	chr1	154180124	397	HLA-C06:08	LRPRVKARI	0.5418	0.982	10	19
STAT3-C1orf43	chr17	40497577	chr1	154180124	397	HLA-B78:02	QPLRPRVKA	0.2787	0.5519	8	17
STAT3-C1orf43	chr17	40497577	chr1	154180124	397	HLA-B67:01	QPLRPRVKA	0.0704	0.7268	8	17
STAT3-C1orf43	chr17	40497577	chr1	154180124	397	HLA-C06:02	LRPRVKARI	0.0082	0.9926	10	19
STAT3-C1orf43	chr17	40497577	chr1	154180124	397	HLA-C06:17	LRPRVKARI	0.0082	0.9926	10	19
STAT3-C1orf43	chr17	40497577	chr1	154180124	397	HLA-A30:01	RLQPLRPRVK	0.9922	0.8723	6	16
STAT3-C1orf43	chr17	40497577	chr1	154180124	397	HLA-A74:01	RLQPLRPRVK	0.966	0.5732	6	16
STAT3-C1orf43	chr17	40497577	chr1	154180124	397	HLA-B27:10	YRLQPLRPRVK	0.9998	0.796	5	16

Top

Potential FusionNeoAntigen Information of STAT3-C1orf43 in HLA II

STAT3-C1orf43_40497577_154180124.msa

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA II	FusionNeoAntigen peptide	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
STAT3-C1orf43	chr17	40497577	chr1	154180124	397	DRB1-1001	NHAFYRLQPLRPRVK	1	16
STAT3-C1orf43	chr17	40497577	chr1	154180124	397	DRB1-1003	NHAFYRLQPLRPRVK	1	16
STAT3-C1orf43	chr17	40497577	chr1	154180124	397	DRB1-1103	LQPLRPRVKARIGSS	7	22
STAT3-C1orf43	chr17	40497577	chr1	154180124	397	DRB1-1121	LQPLRPRVKARIGSS	7	22
STAT3-C1orf43	chr17	40497577	chr1	154180124	397	DRB1-1155	LQPLRPRVKARIGSS	7	22
STAT3-C1orf43	chr17	40497577	chr1	154180124	397	DRB1-1155	RLQPLRPRVKARIGS	6	21
STAT3-C1orf43	chr17	40497577	chr1	154180124	397	DRB1-1155	QPLRPRVKARIGSSQ	8	23
STAT3-C1orf43	chr17	40497577	chr1	154180124	397	DRB1-1163	LQPLRPRVKARIGSS	7	22
STAT3-C1orf43	chr17	40497577	chr1	154180124	397	DRB1-1170	LQPLRPRVKARIGSS	7	22
STAT3-C1orf43	chr17	40497577	chr1	154180124	397	DRB1-1170	RLQPLRPRVKARIGS	6	21
STAT3-C1orf43	chr17	40497577	chr1	154180124	397	DRB1-1176	LQPLRPRVKARIGSS	7	22
STAT3-C1orf43	chr17	40497577	chr1	154180124	397	DRB1-1185	LQPLRPRVKARIGSS	7	22
STAT3-C1orf43	chr17	40497577	chr1	154180124	397	DRB1-1315	LQPLRPRVKARIGSS	7	22
STAT3-C1orf43	chr17	40497577	chr1	154180124	397	DRB1-1319	LQPLRPRVKARIGSS	7	22
STAT3-C1orf43	chr17	40497577	chr1	154180124	397	DRB1-1324	LQPLRPRVKARIGSS	7	22
STAT3-C1orf43	chr17	40497577	chr1	154180124	397	DRB1-1343	LQPLRPRVKARIGSS	7	22
STAT3-C1orf43	chr17	40497577	chr1	154180124	397	DRB1-1343	RLQPLRPRVKARIGS	6	21
STAT3-C1orf43	chr17	40497577	chr1	154180124	397	DRB1-1353	LQPLRPRVKARIGSS	7	22
STAT3-C1orf43	chr17	40497577	chr1	154180124	397	DRB1-1354	LQPLRPRVKARIGSS	7	22
STAT3-C1orf43	chr17	40497577	chr1	154180124	397	DRB1-1354	RLQPLRPRVKARIGS	6	21
STAT3-C1orf43	chr17	40497577	chr1	154180124	397	DRB1-1357	LQPLRPRVKARIGSS	7	22
STAT3-C1orf43	chr17	40497577	chr1	154180124	397	DRB1-1375	LQPLRPRVKARIGSS	7	22
STAT3-C1orf43	chr17	40497577	chr1	154180124	397	DRB1-1375	RLQPLRPRVKARIGS	6	21
STAT3-C1orf43	chr17	40497577	chr1	154180124	397	DRB1-1376	LQPLRPRVKARIGSS	7	22
STAT3-C1orf43	chr17	40497577	chr1	154180124	397	DRB1-1376	RLQPLRPRVKARIGS	6	21
STAT3-C1orf43	chr17	40497577	chr1	154180124	397	DRB1-1416	LQPLRPRVKARIGSS	7	22
STAT3-C1orf43	chr17	40497577	chr1	154180124	397	DRB1-1416	RLQPLRPRVKARIGS	6	21

Top

Fusion breakpoint peptide structures of STAT3-C1orf43

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
8027	RLQPLRPRVKARIG	STAT3	C1orf43	chr17	40497577	chr1	154180124	397

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of STAT3-C1orf43

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	8027	RLQPLRPRVKARIG	-8.55667	-8.74867
HLA-B14:02	3BVN	8027	RLQPLRPRVKARIG	-3.49457	-4.25557
HLA-B52:01	3W39	8027	RLQPLRPRVKARIG	-7.26725	-7.45925
HLA-B52:01	3W39	8027	RLQPLRPRVKARIG	-4.01461	-4.77561
HLA-A24:02	5HGA	8027	RLQPLRPRVKARIG	-7.65911	-8.42011
HLA-A24:02	5HGA	8027	RLQPLRPRVKARIG	-7.10204	-7.29404
HLA-B44:05	3DX8	8027	RLQPLRPRVKARIG	-7.5556	-8.3166
HLA-B44:05	3DX8	8027	RLQPLRPRVKARIG	-2.76159	-2.95359

Top

Vaccine Design for the FusionNeoAntigens of STAT3-C1orf43

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
STAT3-C1orf43	chr17	40497577	chr1	154180124	10	19	LRPRVKARI	GCGGCCCAGGGTTAAAGCACGAATTGG
STAT3-C1orf43	chr17	40497577	chr1	154180124	3	14	AFYRLQPLRPR	CTTCTACAGACTGCAGCCACTGCGGCCCAGGGT
STAT3-C1orf43	chr17	40497577	chr1	154180124	4	14	FYRLQPLRPR	CTACAGACTGCAGCCACTGCGGCCCAGGGT
STAT3-C1orf43	chr17	40497577	chr1	154180124	5	14	YRLQPLRPR	CAGACTGCAGCCACTGCGGCCCAGGGT
STAT3-C1orf43	chr17	40497577	chr1	154180124	5	16	YRLQPLRPRVK	CAGACTGCAGCCACTGCGGCCCAGGGTTAAAGC
STAT3-C1orf43	chr17	40497577	chr1	154180124	6	14	RLQPLRPR	ACTGCAGCCACTGCGGCCCAGGGT
STAT3-C1orf43	chr17	40497577	chr1	154180124	6	15	RLQPLRPRV	ACTGCAGCCACTGCGGCCCAGGGTTAA
STAT3-C1orf43	chr17	40497577	chr1	154180124	6	16	RLQPLRPRVK	ACTGCAGCCACTGCGGCCCAGGGTTAAAGC
STAT3-C1orf43	chr17	40497577	chr1	154180124	8	17	QPLRPRVKA	GCCACTGCGGCCCAGGGTTAAAGCACG

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide	FusionNEoAntigen RNA sequence
STAT3-C1orf43	chr17	40497577	chr1	154180124	1	16	NHAFYRLQPLRPRVK	TCACGCCTTCTACAGACTGCAGCCACTGCGGCCCAGGGTTAAAGC
STAT3-C1orf43	chr17	40497577	chr1	154180124	6	21	RLQPLRPRVKARIGS	ACTGCAGCCACTGCGGCCCAGGGTTAAAGCACGAATTGGGAGCTC
STAT3-C1orf43	chr17	40497577	chr1	154180124	7	22	LQPLRPRVKARIGSS	GCAGCCACTGCGGCCCAGGGTTAAAGCACGAATTGGGAGCTCTCA
STAT3-C1orf43	chr17	40497577	chr1	154180124	8	23	QPLRPRVKARIGSSQ	GCCACTGCGGCCCAGGGTTAAAGCACGAATTGGGAGCTCTCAGCG

Top

Information of the samples that have these potential fusion neoantigens of STAT3-C1orf43

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
LIHC	STAT3-C1orf43	chr17	40497577	ENST00000389272	chr1	154180124	ENST00000350592	TCGA-G3-A7M7-01A

Top

Potential target of CAR-T therapy development for STAT3-C1orf43

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Tgene

C1orf43

chr17:40497577

chr1:154180124

ENST00000368518

11_31

190.0

Transmembrane

Helical

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to STAT3-C1orf43

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to STAT3-C1orf43

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)