Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:TCF12-NPAS1

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: TCF12-NPAS1
	FusionPDB ID: 89715
	FusionGDB2.0 ID: 89715
		Hgene	Tgene
	Gene symbol	TCF12	NPAS1
	Gene ID	6938	4861
	Gene name	transcription factor 12	neuronal PAS domain protein 1
	Synonyms	CRS3\|HEB\|HTF4\|HsT17266\|TCF-12\|bHLHb20\|p64	MOP5\|PASD5\|bHLHe11
	Cytomap	15q21.3	19q13.32
	Type of gene	protein-coding	protein-coding
	Description	transcription factor 12DNA-binding protein HTF4E-box-binding proteinclass B basic helix-loop-helix protein 20helix-loop-helix transcription factor 4transcription factor HTF-4	neuronal PAS domain-containing protein 1PAS domain-containing protein 5basic-helix-loop-helix-PAS protein MOP5class E basic helix-loop-helix protein 11member of PAS protein 5member of PAS superfamily 5neuronal PAS1
	Modification date	20200313	20200313
	UniProtAcc	.	Q99742 Main function of 5'-partner protein: FUNCTION: May control regulatory pathways relevant to schizophrenia and to psychotic illness. May play a role in late central nervous system development by modulating EPO expression in response to cellular oxygen level (By similarity). Forms a heterodimer that binds core DNA sequence 5'-TACGTG-3' within the hypoxia response element (HRE) leading to transcriptional repression on its target gene TH (By similarity). {ECO:0000250, ECO:0000250\|UniProtKB:P97459}.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000267811, ENST00000333725, ENST00000438423, ENST00000452095, ENST00000557843, ENST00000343827, ENST00000537840, ENST00000543579, ENST00000559703, ENST00000559710, ENST00000560764,	ENST00000439365, ENST00000449844, ENST00000602189, ENST00000602212,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	29 X 19 X 12=6612	9 X 4 X 5=180
	# samples	32	12
	** MAII score	log2(32/6612*10)=-4.36894291440495 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(12/180*10)=-0.584962500721156 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: TCF12 [Title/Abstract] AND NPAS1 [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: TCF12 [Title/Abstract] AND NPAS1 [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	TCF12(57213296)-NPAS1(47542294), # samples:2
Anticipated loss of major functional domain due to fusion event.	TCF12-NPAS1 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. TCF12-NPAS1 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. TCF12-NPAS1 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. TCF12-NPAS1 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Hgene	TCF12	GO:0045944	positive regulation of transcription by RNA polymerase II	11802795

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr15:57213296/chr19:47542294)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across TCF12 (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across NPAS1 (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000438423	TCF12	chr15	57213296	+	ENST00000602212	NPAS1	chr19	47542294	+	1653	444	260	1528	422
ENST00000438423	TCF12	chr15	57213296	+	ENST00000602189	NPAS1	chr19	47542294	+	1608	444	260	1531	423
ENST00000438423	TCF12	chr15	57213296	+	ENST00000449844	NPAS1	chr19	47542294	+	1637	444	260	1528	422
ENST00000438423	TCF12	chr15	57213296	+	ENST00000439365	NPAS1	chr19	47542294	+	1589	444	1532	720	270
ENST00000267811	TCF12	chr15	57213296	+	ENST00000602212	NPAS1	chr19	47542294	+	1661	452	304	1536	410
ENST00000267811	TCF12	chr15	57213296	+	ENST00000602189	NPAS1	chr19	47542294	+	1616	452	304	1539	411
ENST00000267811	TCF12	chr15	57213296	+	ENST00000449844	NPAS1	chr19	47542294	+	1645	452	304	1536	410
ENST00000267811	TCF12	chr15	57213296	+	ENST00000439365	NPAS1	chr19	47542294	+	1597	452	1540	728	270
ENST00000452095	TCF12	chr15	57213296	+	ENST00000602212	NPAS1	chr19	47542294	+	1651	442	294	1526	410
ENST00000452095	TCF12	chr15	57213296	+	ENST00000602189	NPAS1	chr19	47542294	+	1606	442	294	1529	411
ENST00000452095	TCF12	chr15	57213296	+	ENST00000449844	NPAS1	chr19	47542294	+	1635	442	294	1526	410
ENST00000452095	TCF12	chr15	57213296	+	ENST00000439365	NPAS1	chr19	47542294	+	1587	442	1530	718	270
ENST00000333725	TCF12	chr15	57213296	+	ENST00000602212	NPAS1	chr19	47542294	+	1592	383	235	1467	410
ENST00000333725	TCF12	chr15	57213296	+	ENST00000602189	NPAS1	chr19	47542294	+	1547	383	235	1470	411
ENST00000333725	TCF12	chr15	57213296	+	ENST00000449844	NPAS1	chr19	47542294	+	1576	383	235	1467	410
ENST00000333725	TCF12	chr15	57213296	+	ENST00000439365	NPAS1	chr19	47542294	+	1528	383	641	1420	259
ENST00000557843	TCF12	chr15	57213296	+	ENST00000602212	NPAS1	chr19	47542294	+	1444	235	51	1319	422
ENST00000557843	TCF12	chr15	57213296	+	ENST00000602189	NPAS1	chr19	47542294	+	1399	235	51	1322	423
ENST00000557843	TCF12	chr15	57213296	+	ENST00000449844	NPAS1	chr19	47542294	+	1428	235	51	1319	422
ENST00000557843	TCF12	chr15	57213296	+	ENST00000439365	NPAS1	chr19	47542294	+	1380	235	493	1272	259

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000438423	ENST00000602212	TCF12	chr15	57213296	+	NPAS1	chr19	47542294	+	0.16974783	0.8302522
ENST00000438423	ENST00000602189	TCF12	chr15	57213296	+	NPAS1	chr19	47542294	+	0.15979207	0.840208
ENST00000438423	ENST00000449844	TCF12	chr15	57213296	+	NPAS1	chr19	47542294	+	0.1739959	0.826004
ENST00000438423	ENST00000439365	TCF12	chr15	57213296	+	NPAS1	chr19	47542294	+	0.6249375	0.37506256
ENST00000267811	ENST00000602212	TCF12	chr15	57213296	+	NPAS1	chr19	47542294	+	0.17093962	0.8290604
ENST00000267811	ENST00000602189	TCF12	chr15	57213296	+	NPAS1	chr19	47542294	+	0.16148555	0.8385144
ENST00000267811	ENST00000449844	TCF12	chr15	57213296	+	NPAS1	chr19	47542294	+	0.17520836	0.82479167
ENST00000267811	ENST00000439365	TCF12	chr15	57213296	+	NPAS1	chr19	47542294	+	0.6192917	0.38070828
ENST00000452095	ENST00000602212	TCF12	chr15	57213296	+	NPAS1	chr19	47542294	+	0.17577247	0.8242276
ENST00000452095	ENST00000602189	TCF12	chr15	57213296	+	NPAS1	chr19	47542294	+	0.16628559	0.8337144
ENST00000452095	ENST00000449844	TCF12	chr15	57213296	+	NPAS1	chr19	47542294	+	0.1801364	0.81986356
ENST00000452095	ENST00000439365	TCF12	chr15	57213296	+	NPAS1	chr19	47542294	+	0.6593644	0.3406356
ENST00000333725	ENST00000602212	TCF12	chr15	57213296	+	NPAS1	chr19	47542294	+	0.17310353	0.8268964
ENST00000333725	ENST00000602189	TCF12	chr15	57213296	+	NPAS1	chr19	47542294	+	0.16272949	0.8372705
ENST00000333725	ENST00000449844	TCF12	chr15	57213296	+	NPAS1	chr19	47542294	+	0.1770716	0.8229284
ENST00000333725	ENST00000439365	TCF12	chr15	57213296	+	NPAS1	chr19	47542294	+	0.5980655	0.40193453
ENST00000557843	ENST00000602212	TCF12	chr15	57213296	+	NPAS1	chr19	47542294	+	0.13831165	0.8616884
ENST00000557843	ENST00000602189	TCF12	chr15	57213296	+	NPAS1	chr19	47542294	+	0.13322768	0.86677235
ENST00000557843	ENST00000449844	TCF12	chr15	57213296	+	NPAS1	chr19	47542294	+	0.1429838	0.85701615
ENST00000557843	ENST00000439365	TCF12	chr15	57213296	+	NPAS1	chr19	47542294	+	0.49977896	0.5002211

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for TCF12-NPAS1

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
TCF12	chr15	57213296	NPAS1	chr19	47542294	235	61	RPTTLGSSQFSGSEASLTKVPPSSLV
TCF12	chr15	57213296	NPAS1	chr19	47542294	383	49	RPTTLGSSQFSGSEASLTKVPPSSLV
TCF12	chr15	57213296	NPAS1	chr19	47542294	442	49	RPTTLGSSQFSGSEASLTKVPPSSLV
TCF12	chr15	57213296	NPAS1	chr19	47542294	444	61	RPTTLGSSQFSGSEASLTKVPPSSLV
TCF12	chr15	57213296	NPAS1	chr19	47542294	452	49	RPTTLGSSQFSGSEASLTKVPPSSLV

Top

Potential FusionNeoAntigen Information of TCF12-NPAS1 in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

TCF12-NPAS1_57213296_47542294.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
TCF12-NPAS1	chr15	57213296	chr19	47542294	452	HLA-B50:02	SEASLTKV	0.9999	0.7093	12	20
TCF12-NPAS1	chr15	57213296	chr19	47542294	452	HLA-B41:01	SEASLTKV	0.9822	0.7843	12	20
TCF12-NPAS1	chr15	57213296	chr19	47542294	452	HLA-B50:01	SEASLTKV	0.9334	0.7644	12	20
TCF12-NPAS1	chr15	57213296	chr19	47542294	452	HLA-B45:01	SEASLTKVP	0.9966	0.9102	12	21
TCF12-NPAS1	chr15	57213296	chr19	47542294	452	HLA-B50:02	SEASLTKVP	0.9945	0.7303	12	21
TCF12-NPAS1	chr15	57213296	chr19	47542294	452	HLA-B41:01	SEASLTKVP	0.7198	0.8521	12	21
TCF12-NPAS1	chr15	57213296	chr19	47542294	452	HLA-B50:01	SEASLTKVP	0.4142	0.7903	12	21
TCF12-NPAS1	chr15	57213296	chr19	47542294	452	HLA-B15:01	SQFSGSEASL	0.9993	0.8607	7	17
TCF12-NPAS1	chr15	57213296	chr19	47542294	452	HLA-B45:01	SEASLTKVPP	0.9948	0.8968	12	22
TCF12-NPAS1	chr15	57213296	chr19	47542294	452	HLA-B50:02	SEASLTKVPP	0.9878	0.6857	12	22
TCF12-NPAS1	chr15	57213296	chr19	47542294	452	HLA-B48:01	SQFSGSEASL	0.986	0.7599	7	17
TCF12-NPAS1	chr15	57213296	chr19	47542294	452	HLA-B39:01	SQFSGSEASL	0.9697	0.9292	7	17
TCF12-NPAS1	chr15	57213296	chr19	47542294	452	HLA-B41:01	SEASLTKVPP	0.9663	0.8221	12	22
TCF12-NPAS1	chr15	57213296	chr19	47542294	452	HLA-B15:03	SQFSGSEASL	0.9516	0.7803	7	17
TCF12-NPAS1	chr15	57213296	chr19	47542294	452	HLA-B50:01	SEASLTKVPP	0.9507	0.7765	12	22
TCF12-NPAS1	chr15	57213296	chr19	47542294	452	HLA-B39:13	SQFSGSEASL	0.9133	0.9394	7	17
TCF12-NPAS1	chr15	57213296	chr19	47542294	452	HLA-B15:10	SQFSGSEASL	0.9038	0.5806	7	17
TCF12-NPAS1	chr15	57213296	chr19	47542294	452	HLA-B38:01	SQFSGSEASL	0.8733	0.9713	7	17
TCF12-NPAS1	chr15	57213296	chr19	47542294	452	HLA-B13:02	SQFSGSEASL	0.8651	0.7652	7	17
TCF12-NPAS1	chr15	57213296	chr19	47542294	452	HLA-B47:01	SQFSGSEASL	0.8481	0.5088	7	17
TCF12-NPAS1	chr15	57213296	chr19	47542294	452	HLA-B13:01	SQFSGSEASL	0.8215	0.9749	7	17
TCF12-NPAS1	chr15	57213296	chr19	47542294	452	HLA-B52:01	SQFSGSEASL	0.2435	0.9842	7	17
TCF12-NPAS1	chr15	57213296	chr19	47542294	452	HLA-B40:06	SEASLTKV	0.9999	0.6626	12	20
TCF12-NPAS1	chr15	57213296	chr19	47542294	452	HLA-B40:06	SEASLTKVP	0.9846	0.6356	12	21
TCF12-NPAS1	chr15	57213296	chr19	47542294	452	HLA-B15:07	SQFSGSEASL	0.998	0.7098	7	17
TCF12-NPAS1	chr15	57213296	chr19	47542294	452	HLA-B15:04	SQFSGSEASL	0.9966	0.9086	7	17
TCF12-NPAS1	chr15	57213296	chr19	47542294	452	HLA-B39:08	SQFSGSEASL	0.9765	0.8606	7	17
TCF12-NPAS1	chr15	57213296	chr19	47542294	452	HLA-B39:09	SQFSGSEASL	0.9761	0.7196	7	17
TCF12-NPAS1	chr15	57213296	chr19	47542294	452	HLA-B39:05	SQFSGSEASL	0.8791	0.9168	7	17
TCF12-NPAS1	chr15	57213296	chr19	47542294	452	HLA-B15:05	SQFSGSEASL	0.7597	0.8034	7	17
TCF12-NPAS1	chr15	57213296	chr19	47542294	452	HLA-B40:04	SEASLTKV	0.9996	0.7766	12	20
TCF12-NPAS1	chr15	57213296	chr19	47542294	452	HLA-B50:05	SEASLTKV	0.9334	0.7644	12	20
TCF12-NPAS1	chr15	57213296	chr19	47542294	452	HLA-B50:04	SEASLTKV	0.9334	0.7644	12	20
TCF12-NPAS1	chr15	57213296	chr19	47542294	452	HLA-B50:04	SEASLTKVP	0.4142	0.7903	12	21
TCF12-NPAS1	chr15	57213296	chr19	47542294	452	HLA-B50:05	SEASLTKVP	0.4142	0.7903	12	21
TCF12-NPAS1	chr15	57213296	chr19	47542294	452	HLA-C14:02	QFSGSEASL	0.1527	0.9752	8	17
TCF12-NPAS1	chr15	57213296	chr19	47542294	452	HLA-C14:03	QFSGSEASL	0.1527	0.9752	8	17
TCF12-NPAS1	chr15	57213296	chr19	47542294	452	HLA-B15:34	SQFSGSEASL	0.9993	0.8607	7	17
TCF12-NPAS1	chr15	57213296	chr19	47542294	452	HLA-B15:125	SQFSGSEASL	0.9993	0.8607	7	17
TCF12-NPAS1	chr15	57213296	chr19	47542294	452	HLA-B15:33	SQFSGSEASL	0.9993	0.8607	7	17
TCF12-NPAS1	chr15	57213296	chr19	47542294	452	HLA-B15:135	SQFSGSEASL	0.9993	0.8743	7	17
TCF12-NPAS1	chr15	57213296	chr19	47542294	452	HLA-B15:27	SQFSGSEASL	0.9992	0.8777	7	17
TCF12-NPAS1	chr15	57213296	chr19	47542294	452	HLA-B15:54	SQFSGSEASL	0.9985	0.8179	7	17
TCF12-NPAS1	chr15	57213296	chr19	47542294	452	HLA-B15:53	SQFSGSEASL	0.9983	0.8338	7	17
TCF12-NPAS1	chr15	57213296	chr19	47542294	452	HLA-B15:50	SQFSGSEASL	0.9982	0.8452	7	17
TCF12-NPAS1	chr15	57213296	chr19	47542294	452	HLA-B15:35	SQFSGSEASL	0.9979	0.8557	7	17
TCF12-NPAS1	chr15	57213296	chr19	47542294	452	HLA-B15:68	SQFSGSEASL	0.9978	0.6532	7	17
TCF12-NPAS1	chr15	57213296	chr19	47542294	452	HLA-B15:73	SQFSGSEASL	0.996	0.9605	7	17
TCF12-NPAS1	chr15	57213296	chr19	47542294	452	HLA-B15:30	SQFSGSEASL	0.9934	0.8192	7	17
TCF12-NPAS1	chr15	57213296	chr19	47542294	452	HLA-B15:12	SQFSGSEASL	0.9775	0.8484	7	17
TCF12-NPAS1	chr15	57213296	chr19	47542294	452	HLA-B39:02	SQFSGSEASL	0.9769	0.9385	7	17
TCF12-NPAS1	chr15	57213296	chr19	47542294	452	HLA-B39:11	SQFSGSEASL	0.9742	0.8864	7	17
TCF12-NPAS1	chr15	57213296	chr19	47542294	452	HLA-B39:31	SQFSGSEASL	0.9709	0.9298	7	17
TCF12-NPAS1	chr15	57213296	chr19	47542294	452	HLA-B50:04	SEASLTKVPP	0.9507	0.7765	12	22
TCF12-NPAS1	chr15	57213296	chr19	47542294	452	HLA-B50:05	SEASLTKVPP	0.9507	0.7765	12	22
TCF12-NPAS1	chr15	57213296	chr19	47542294	452	HLA-B48:02	SQFSGSEASL	0.8941	0.8666	7	17
TCF12-NPAS1	chr15	57213296	chr19	47542294	452	HLA-B38:05	SQFSGSEASL	0.8733	0.9713	7	17
TCF12-NPAS1	chr15	57213296	chr19	47542294	452	HLA-B15:09	SQFSGSEASL	0.7615	0.8928	7	17
TCF12-NPAS1	chr15	57213296	chr19	47542294	452	HLA-B15:20	SQFSGSEASL	0.7504	0.8673	7	17
TCF12-NPAS1	chr15	57213296	chr19	47542294	452	HLA-B35:28	SQFSGSEASL	0.7273	0.8881	7	17

Top

Potential FusionNeoAntigen Information of TCF12-NPAS1 in HLA II

TCF12-NPAS1_57213296_47542294.msa

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA II	FusionNeoAntigen peptide	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
TCF12-NPAS1	chr15	57213296	chr19	47542294	452	DRB1-0901	SSQFSGSEASLTKVP	6	21
TCF12-NPAS1	chr15	57213296	chr19	47542294	452	DRB1-0902	SSQFSGSEASLTKVP	6	21
TCF12-NPAS1	chr15	57213296	chr19	47542294	452	DRB1-0908	SSQFSGSEASLTKVP	6	21
TCF12-NPAS1	chr15	57213296	chr19	47542294	452	DRB1-0909	SSQFSGSEASLTKVP	6	21

Top

Fusion breakpoint peptide structures of TCF12-NPAS1

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
9042	SSQFSGSEASLTKV	TCF12	NPAS1	chr15	57213296	chr19	47542294	452

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of TCF12-NPAS1

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B51:01	1E28	9042	SSQFSGSEASLTKV	-2.66736	-2.78076
HLA-A03:01	2XPG	9042	SSQFSGSEASLTKV	-1.51105	-2.54635
HLA-B14:02	3BVN	9042	SSQFSGSEASLTKV	-5.83247	-5.94587
HLA-B14:02	3BVN	9042	SSQFSGSEASLTKV	-3.51703	-4.55233
HLA-B52:01	3W39	9042	SSQFSGSEASLTKV	-5.64143	-6.67673
HLA-B52:01	3W39	9042	SSQFSGSEASLTKV	-5.35834	-5.47174
HLA-B18:01	4JQV	9042	SSQFSGSEASLTKV	-4.10602	-5.14132
HLA-B18:01	4JQV	9042	SSQFSGSEASLTKV	-3.86802	-3.98142
HLA-A11:01	4UQ2	9042	SSQFSGSEASLTKV	-9.64733	-9.76073
HLA-A11:01	4UQ2	9042	SSQFSGSEASLTKV	-2.23117	-3.26647
HLA-A24:02	5HGA	9042	SSQFSGSEASLTKV	-5.71077	-5.82417
HLA-A24:02	5HGA	9042	SSQFSGSEASLTKV	-3.6538	-4.6891
HLA-C08:02	6JTP	9042	SSQFSGSEASLTKV	-5.36916	-5.48256
HLA-B27:05	6PYJ	9042	SSQFSGSEASLTKV	-6.42081	-7.45611
HLA-B27:05	6PYJ	9042	SSQFSGSEASLTKV	-5.71384	-5.82724
HLA-B27:03	6PZ5	9042	SSQFSGSEASLTKV	-3.23395	-3.34735
HLA-B27:03	6PZ5	9042	SSQFSGSEASLTKV	-2.07721	-3.11251
HLA-B44:05	3DX8	9042	SSQFSGSEASLTKV	-5.14294	-5.25634
HLA-B44:05	3DX8	9042	SSQFSGSEASLTKV	-3.98213	-5.01743
HLA-A02:01	6TDR	9042	SSQFSGSEASLTKV	-4.77803	-5.81333

Top

Vaccine Design for the FusionNeoAntigens of TCF12-NPAS1

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
TCF12-NPAS1	chr15	57213296	chr19	47542294	12	20	SEASLTKV	CAGAGGCCAGCCTCACCAAGGTGC
TCF12-NPAS1	chr15	57213296	chr19	47542294	12	21	SEASLTKVP	CAGAGGCCAGCCTCACCAAGGTGCCCC
TCF12-NPAS1	chr15	57213296	chr19	47542294	12	22	SEASLTKVPP	CAGAGGCCAGCCTCACCAAGGTGCCCCCCT
TCF12-NPAS1	chr15	57213296	chr19	47542294	7	17	SQFSGSEASL	GTCAATTCAGTGGATCAGAGGCCAGCCTCA
TCF12-NPAS1	chr15	57213296	chr19	47542294	8	17	QFSGSEASL	AATTCAGTGGATCAGAGGCCAGCCTCA

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide	FusionNEoAntigen RNA sequence
TCF12-NPAS1	chr15	57213296	chr19	47542294	6	21	SSQFSGSEASLTKVP	GCAGTCAATTCAGTGGATCAGAGGCCAGCCTCACCAAGGTGCCCC

Top

Information of the samples that have these potential fusion neoantigens of TCF12-NPAS1

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
PRAD	TCF12-NPAS1	chr15	57213296	ENST00000267811	chr19	47542294	ENST00000449844	TCGA-EJ-A8FO-01A

Top

Potential target of CAR-T therapy development for TCF12-NPAS1

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to TCF12-NPAS1

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to TCF12-NPAS1

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)